RchiOBHm_Chr5g0082371

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
88371768 .. 88376691
4924 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 309 bp
ATGCTTTCGCCATCATCAGTTCAGGGGTTTCAAGAATTTCATGGAGAGGCAAACATCTTGCTGACTGAAAACTTCCAAGCCAAAGTATCTGATTTTGGCCTATCCAGAAATTTCCCTACAGACCTTGTGACACATATAACAACTGGCGTTGTTGGTACTCTCAGGTACCTTGACCCTGAGATGAGCTGTGTAATGGCAATGACATTGATAAGCACACCTACTAGCATGAGCAGAAAGCAATCCTATGGAGAAGGATGGCTTGATGGTGAACGCTACTGGGTTAAATACTTCAAATATAGGTTTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

102

Amino Acids

11.6

Weight (kDa)

6.05

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 165
AccB1I GGYRCC 1 cut(s) 165
AcsI RAATTY 2 cut(s) 35, 109
AfaI GTAC 2 cut(s) 157, 167
AgsI TTSAA 2 cut(s) 32, 292
AluBI AGCT 1 cut(s) 186
AluI AGCT 1 cut(s) 186
AoxI GGCC 1 cut(s) 97
ApoI RAATTY 2 cut(s) 35, 109
Asp718I GGTACC 1 cut(s) 165
AsuHPI GGTGA 1 cut(s) 278
BanI GGYRCC 1 cut(s) 165
BccI CCATC 3 cut(s) 19, 249, 257
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 167
BmrI ACTGGG 1 cut(s) 286
BmuI ACTGGG 1 cut(s) 286
Bse1I ACTGG 2 cut(s) 148, 281
Bse3DI GCAATG 1 cut(s) 204
BseGI GGATG 1 cut(s) 260
BseMI GCAATG 1 cut(s) 204
BseMII CTCAG 2 cut(s) 168, 175
BseNI ACTGG 2 cut(s) 148, 281
BshFI GGCC 1 cut(s) 99
BshNI GGYRCC 1 cut(s) 165
BsnI GGCC 1 cut(s) 99
BspANI GGCC 1 cut(s) 99
BspCNI CTCAG 2 cut(s) 169, 174
BspLI GGNNCC 1 cut(s) 167
BspT107I GGYRCC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 204
BsrI ACTGG 2 cut(s) 148, 281
BstDEI CTNAG 2 cut(s) 161, 177
BstF5I GGATG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 99
BtsCI GGATG 1 cut(s) 260
Csp6I GTAC 2 cut(s) 156, 166
CviAII CATG 2 cut(s) 41, 226
CviJI RGCY 5 cut(s) 80, 99, 186, 259, 306
CviKI_1 RGCY 5 cut(s) 80, 99, 186, 259, 306
CviQI GTAC 2 cut(s) 156, 166
DdeI CTNAG 2 cut(s) 161, 177
FaeI CATG 2 cut(s) 44, 229
FaiI YATR 6 cut(s) 42, 135, 137, 227, 246, 297
FalI AAGNNNNNCTT 2 cut(s) 243, 275
FatI CATG 2 cut(s) 40, 225
FokI GGATG 1 cut(s) 267
FspBI CTAG 1 cut(s) 222
HaeIII GGCC 1 cut(s) 99
Hin1II CATG 2 cut(s) 44, 229
HphI GGTGA 1 cut(s) 278
Hpy166II GTNNAC 1 cut(s) 269
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 32, 105
Hpy8I GTNNAC 1 cut(s) 269
HpyAV CCTTC 1 cut(s) 245
HpyF3I CTNAG 2 cut(s) 161, 177
Hsp92II CATG 2 cut(s) 44, 229
KpnI GGTACC 1 cut(s) 169
LpnPI CCDG 6 cut(s) 8, 118, 129, 148, 189, 262
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 127
MluCI AATT 2 cut(s) 35, 109
MnlI CCTC 1 cut(s) 40
MseI TTAA 1 cut(s) 282
NlaIII CATG 2 cut(s) 44, 229
NlaIV GGNNCC 1 cut(s) 167
NmuCI GTSAC 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 167
RsaI GTAC 2 cut(s) 157, 167
RsaNI GTAC 2 cut(s) 156, 166
SaqAI TTAA 1 cut(s) 282
SetI ASST 6 cut(s) 126, 167, 171, 188, 220, 302
SfcI CTRYAG 1 cut(s) 117
Sse9I AATT 2 cut(s) 35, 109
SspMI CTAG 1 cut(s) 222
TasI AATT 2 cut(s) 35, 109
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 29
XapI RAATTY 2 cut(s) 35, 109
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.