RchiOBHm_Chr5g0054821

Protein ROOT HAIR DEFECTIVE 3 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
57514353 .. 57529781
15429 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33189

Sequence Viewer

Length: 258 bp
ATGAGATATGACATGGAGGCCATCTACTTTGATGAAGGTGTAAGGAACTCAAGACGACACCAATTGAAAACAAGAGCATTGGATGAGCTATGTAATGGCAGTGACATTGAGAAGCGCACAGCTACTAGCATGAGCAGAAAGCAATTCTATGGAGAAGGATGGCTTGATGGTGAATGCTACTGGGTTAAATACTTTAAATACAGAATCTGTATTCAGTATTTACAATATGACTTGCATTGGGTGAGGTTTTTCGAGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

10.56

Weight (kDa)

7.7

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 67
AluBI AGCT 2 cut(s) 88, 122
AluI AGCT 2 cut(s) 88, 122
AlwNI CAGNNNCTG 1 cut(s) 207
AoxI GGCC 1 cut(s) 18
AspLEI GCGC 1 cut(s) 117
AsuHPI GGTGA 2 cut(s) 182, 253
BccI CCATC 3 cut(s) 29, 153, 161
BfaI CTAG 1 cut(s) 126
BmrI ACTGGG 1 cut(s) 190
BmuI ACTGGG 1 cut(s) 190
BpuEI CTTGAG 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 185
BseGI GGATG 2 cut(s) 88, 164
BseNI ACTGG 1 cut(s) 185
BshFI GGCC 1 cut(s) 20
BsmI GAATGC 1 cut(s) 179
BsnI GGCC 1 cut(s) 20
BspANI GGCC 1 cut(s) 20
BsrI ACTGG 1 cut(s) 185
BstF5I GGATG 2 cut(s) 88, 164
BstHHI GCGC 1 cut(s) 117
BsuRI GGCC 1 cut(s) 20
BtsCI GGATG 2 cut(s) 88, 164
BtsI GCAGTG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 106
CaiI CAGNNNCTG 1 cut(s) 207
CfoI GCGC 1 cut(s) 117
CviAII CATG 2 cut(s) 13, 130
CviJI RGCY 4 cut(s) 20, 88, 122, 163
CviKI_1 RGCY 4 cut(s) 20, 88, 122, 163
DraI TTTAAA 1 cut(s) 196
FaeI CATG 2 cut(s) 16, 133
FaiI YATR 6 cut(s) 9, 14, 91, 131, 150, 228
FalI AAGNNNNNCTT 2 cut(s) 147, 179
FatI CATG 2 cut(s) 12, 129
FokI GGATG 2 cut(s) 95, 171
FspBI CTAG 1 cut(s) 126
GlaI GCGC 1 cut(s) 116
HaeIII GGCC 1 cut(s) 20
HhaI GCGC 1 cut(s) 117
Hin1II CATG 2 cut(s) 16, 133
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HinfI GANTC 1 cut(s) 204
HphI GGTGA 2 cut(s) 182, 253
Hpy188III TCNNGA 1 cut(s) 51
HpyAV CCTTC 2 cut(s) 29, 149
HpyCH4V TGCA 1 cut(s) 235
Hsp92II CATG 2 cut(s) 16, 133
HspAI GCGC 1 cut(s) 115
LpnPI CCDG 1 cut(s) 166
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 101
MfeI CAATTG 1 cut(s) 62
MluCI AATT 2 cut(s) 62, 143
MnlI CCTC 2 cut(s) 10, 237
MseI TTAA 2 cut(s) 186, 195
MunI CAATTG 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 179
NlaIII CATG 2 cut(s) 16, 133
NmuCI GTSAC 1 cut(s) 101
PctI GAATGC 1 cut(s) 179
PfeI GAWTC 1 cut(s) 204
PstNI CAGNNNCTG 1 cut(s) 207
SaqAI TTAA 2 cut(s) 186, 195
SetI ASST 4 cut(s) 40, 90, 124, 248
SgeI CNNG 8 cut(s) 25, 63, 84, 138, 142, 176, 193, 244
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 2 cut(s) 62, 143
SspMI CTAG 1 cut(s) 126
TaqI TCGA 1 cut(s) 252
TasI AATT 2 cut(s) 62, 143
TfiI GAWTC 1 cut(s) 204
Tru1I TTAA 2 cut(s) 186, 195
Tru9I TTAA 2 cut(s) 186, 195
TscAI CASTG 1 cut(s) 106
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 1 cut(s) 106
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.