Rroxscaffold_1G00026160

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
32916439 .. 32924647
8209 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00026160.1

Sequence Viewer

Length: 390 bp
ATGGAGAAGGATGGCTTGATGGTGAATGCTACTGGGTTAAATACTTCAAATATAGACCAACCTGATGCATTGACACTACTGGGATCTGAAAGATCATTCAAATCTCCCAAAGGTTTGTTCGCATTTGCTTCTTCAACAGACATGACGACTGCAACTCGACCCACCTGGGCTCCTGCAAAGGATGGCTCAGAAATCATTGATGTTGAACAGCACCACAAGAGCAATAATGACAGCTTTTTCATTATTGAGGTGCTCCTACAGCTTAGGACCACATGCAGGGAGATGTGGTTTCTGCTTTTCAAAGTAAAAGAAACAGCTTTTTCGATATTGAGGTGCTCCTACAGATTAGGACCACATGCAGAGAGATGTGGTTTCTGCTTTTCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.51

Weight (kDa)

6.82

Isoelectric Point (pI)

37.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 276
AgsI TTSAA 6 cut(s) 48, 100, 135, 206, 301, 384
AjnI CCWGG 1 cut(s) 164
AjuI GAANNNNNNNTTGG 2 cut(s) 101, 133
AluBI AGCT 3 cut(s) 234, 262, 317
AluI AGCT 3 cut(s) 234, 262, 317
Alw21I GWGCWC 2 cut(s) 255, 338
AlwI GGATC 1 cut(s) 91
AspS9I GGNCC 2 cut(s) 267, 350
AsuHPI GGTGA 1 cut(s) 34
AvaII GGWCC 2 cut(s) 267, 350
BanII GRGCYC 1 cut(s) 172
Bbv12I GWGCWC 2 cut(s) 255, 338
BccI CCATC 3 cut(s) 5, 13, 176
BciT130I CCWGG 1 cut(s) 166
BfmI CTRYAG 2 cut(s) 257, 340
Bme1390I CCNGG 1 cut(s) 166
Bme18I GGWCC 2 cut(s) 267, 350
BmgT120I GGNCC 2 cut(s) 267, 350
BmiI GGNNCC 1 cut(s) 171
BmrFI CCNGG 1 cut(s) 166
BmrI ACTGGG 2 cut(s) 42, 89
BmsI GCATC 1 cut(s) 55
BmuI ACTGGG 2 cut(s) 42, 89
Bpu10I CCTNAGC 1 cut(s) 263
BsaJI CCNNGG 1 cut(s) 165
BsaXI ACNNNNNCTCC 4 cut(s) 154, 184, 272, 302
Bsc4I CCNNNNNNNGG 1 cut(s) 276
Bse1I ACTGG 2 cut(s) 37, 84
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 165
BseGI GGATG 2 cut(s) 16, 187
BseLI CCNNNNNNNGG 1 cut(s) 276
BseMII CTCAG 1 cut(s) 201
BseNI ACTGG 2 cut(s) 37, 84
BsiHKAI GWGCWC 2 cut(s) 255, 338
BslI CCNNNNNNNGG 1 cut(s) 276
BsmI GAATGC 1 cut(s) 31
Bsp1286I GDGCHC 3 cut(s) 172, 255, 338
Bsp143I GATC 2 cut(s) 83, 92
BspCNI CTCAG 1 cut(s) 200
BspLI GGNNCC 1 cut(s) 171
BspPI GGATC 1 cut(s) 91
BsrI ACTGG 2 cut(s) 37, 84
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 2 cut(s) 83, 92
Bst2UI CCWGG 1 cut(s) 166
BstDEI CTNAG 2 cut(s) 187, 263
BstF5I GGATG 2 cut(s) 16, 187
BstKTI GATC 2 cut(s) 86, 95
BstMBI GATC 2 cut(s) 83, 92
BstMWI GCNNNNNNNGC 1 cut(s) 259
BstNI CCWGG 1 cut(s) 166
BstNSI RCATGY 2 cut(s) 276, 359
BstSCI CCNGG 1 cut(s) 164
BstSFI CTRYAG 2 cut(s) 257, 340
BstX2I RGATCY 1 cut(s) 83
BstYI RGATCY 1 cut(s) 83
BtsCI GGATG 2 cut(s) 16, 187
Cfr13I GGNCC 2 cut(s) 267, 350
CviAII CATG 3 cut(s) 142, 273, 356
CviJI RGCY 6 cut(s) 15, 170, 186, 234, 262, 317
CviKI_1 RGCY 6 cut(s) 15, 170, 186, 234, 262, 317
DdeI CTNAG 2 cut(s) 187, 263
DpnI GATC 2 cut(s) 85, 94
DpnII GATC 2 cut(s) 83, 92
Eco24I GRGCYC 1 cut(s) 172
Eco47I GGWCC 2 cut(s) 267, 350
EcoRII CCWGG 1 cut(s) 164
EcoT22I ATGCAT 1 cut(s) 70
EcoT38I GRGCYC 1 cut(s) 172
FaeI CATG 3 cut(s) 145, 276, 359
FaiI YATR 4 cut(s) 53, 143, 274, 357
FalI AAGNNNNNCTT 1 cut(s) 31
FatI CATG 3 cut(s) 141, 272, 355
FokI GGATG 2 cut(s) 23, 194
FriOI GRGCYC 1 cut(s) 172
Hin1II CATG 3 cut(s) 145, 276, 359
HphI GGTGA 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 88, 190
HpyCH4V TGCA 5 cut(s) 68, 152, 176, 276, 359
HpyF10VI GCNNNNNNNGC 1 cut(s) 259
HpyF3I CTNAG 2 cut(s) 187, 263
Hsp92II CATG 3 cut(s) 145, 276, 359
Kzo9I GATC 2 cut(s) 83, 92
LmnI GCTCC 3 cut(s) 175, 258, 341
LpnPI CCDG 7 cut(s) 18, 65, 75, 151, 178, 186, 262
LweI GCATC 1 cut(s) 55
MalI GATC 2 cut(s) 85, 94
MboI GATC 2 cut(s) 83, 92
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 83
MhlI GDGCHC 3 cut(s) 172, 255, 338
MnlI CCTC 2 cut(s) 241, 324
Mph1103I ATGCAT 1 cut(s) 70
MseI TTAA 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 166
Mva1269I GAATGC 1 cut(s) 31
MvaI CCWGG 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 259
NdeII GATC 2 cut(s) 83, 92
NlaIII CATG 3 cut(s) 145, 276, 359
NlaIV GGNNCC 1 cut(s) 171
NsiI ATGCAT 1 cut(s) 70
NspI RCATGY 2 cut(s) 276, 359
PctI GAATGC 1 cut(s) 31
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 171
PspPI GGNCC 2 cut(s) 267, 350
PsuI RGATCY 1 cut(s) 83
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 2 cut(s) 83, 92
Sau96I GGNCC 2 cut(s) 267, 350
ScrFI CCNGG 1 cut(s) 166
SduI GDGCHC 3 cut(s) 172, 255, 338
SetI ASST 8 cut(s) 64, 115, 167, 236, 252, 264, 319, 335
SfaNI GCATC 1 cut(s) 55
SfcI CTRYAG 2 cut(s) 257, 340
SinI GGWCC 2 cut(s) 267, 350
StyD4I CCNGG 1 cut(s) 164
TaqI TCGA 2 cut(s) 157, 323
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 229
VpaK11BI GGWCC 2 cut(s) 267, 350
XceI RCATGY 2 cut(s) 276, 359
Zsp2I ATGCAT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.