Rh5AG359300

Protein ROOT HAIR DEFECTIVE 3 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
60419772 .. 60435749
15978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG359300.1

Sequence Viewer

Length: 252 bp
ATGAGATATGGCATGGAGGCCATCTACTTTGATGAAGGTGTAAGGAACTCAAGACGACACCAATTGGATGAGCTATGTAATGACAGTGACATTGATAAGCGCACAGCTACTAGCATGAGTAGAAAGCAATTCTATGGAGAAGGATGGCTTTATGGTGAATGCTGCTGGACATTGAAAGAGATAGAATTTATAGCTAATCTAGTGACCACTGGCCAGCTTCAGACCTTCAGTCGTAATGCACTAAAGGACTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.75

Weight (kDa)

5.35

Isoelectric Point (pI)

58.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 211
AcsI RAATTY 1 cut(s) 185
AcuI CTGAAG 2 cut(s) 203, 211
AgsI TTSAA 1 cut(s) 175
AhdI GACNNNNNGTC 1 cut(s) 228
AluBI AGCT 4 cut(s) 73, 107, 194, 217
AluI AGCT 4 cut(s) 73, 107, 194, 217
AoxI GGCC 2 cut(s) 18, 211
ApeKI GCWGC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 185
AspLEI GCGC 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 167
BalI TGGCCA 1 cut(s) 213
BbvI GCAGC 1 cut(s) 149
BccI CCATC 2 cut(s) 29, 138
BfaI CTAG 3 cut(s) 111, 200, 250
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
BmeRI GACNNNNNGTC 1 cut(s) 228
BpuEI CTTGAG 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 214
BseGI GGATG 2 cut(s) 73, 149
BseNI ACTGG 1 cut(s) 214
BseXI GCAGC 1 cut(s) 149
BshFI GGCC 2 cut(s) 20, 213
BsmI GAATGC 1 cut(s) 164
BsnI GGCC 2 cut(s) 20, 213
BspANI GGCC 2 cut(s) 20, 213
BsrI ACTGG 1 cut(s) 214
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 215
BstF5I GGATG 2 cut(s) 73, 149
BstHHI GCGC 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 149
BsuRI GGCC 2 cut(s) 20, 213
BtsCI GGATG 2 cut(s) 73, 149
BtsIMutI CAGTG 2 cut(s) 91, 207
Cac8I GCNNGC 1 cut(s) 215
CfoI GCGC 1 cut(s) 102
CviAII CATG 2 cut(s) 13, 115
CviJI RGCY 7 cut(s) 20, 73, 107, 148, 194, 213, 217
CviKI_1 RGCY 7 cut(s) 20, 73, 107, 148, 194, 213, 217
DriI GACNNNNNGTC 1 cut(s) 228
EaeI YGGCCR 1 cut(s) 211
Eam1105I GACNNNNNGTC 1 cut(s) 228
Eco57I CTGAAG 2 cut(s) 203, 211
FaeI CATG 2 cut(s) 16, 118
FaiI YATR 7 cut(s) 9, 14, 76, 116, 135, 153, 191
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FatI CATG 2 cut(s) 12, 114
Fnu4HI GCNGC 1 cut(s) 163
FokI GGATG 2 cut(s) 80, 156
Fsp4HI GCNGC 1 cut(s) 163
FspBI CTAG 3 cut(s) 111, 200, 250
GlaI GCGC 1 cut(s) 101
GluI GCNGC 1 cut(s) 163
HaeIII GGCC 2 cut(s) 20, 213
HhaI GCGC 1 cut(s) 102
Hin1II CATG 2 cut(s) 16, 118
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HphI GGTGA 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 51
HpyAV CCTTC 3 cut(s) 29, 134, 235
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 239
Hsp92II CATG 2 cut(s) 16, 118
HspAI GCGC 1 cut(s) 100
LpnPI CCDG 3 cut(s) 151, 195, 227
Lsp1109I GCAGC 1 cut(s) 149
MaeI CTAG 3 cut(s) 111, 200, 250
MaeIII GTNAC 2 cut(s) 86, 202
MfeI CAATTG 1 cut(s) 62
MlsI TGGCCA 1 cut(s) 213
MluCI AATT 3 cut(s) 62, 128, 185
MluNI TGGCCA 1 cut(s) 213
MnlI CCTC 1 cut(s) 10
Mox20I TGGCCA 1 cut(s) 213
MscI TGGCCA 1 cut(s) 213
Msp20I TGGCCA 1 cut(s) 213
MunI CAATTG 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 164
NlaIII CATG 2 cut(s) 16, 118
NmuCI GTSAC 2 cut(s) 86, 202
PctI GAATGC 1 cut(s) 164
PkrI GCNGC 1 cut(s) 164
SatI GCNGC 1 cut(s) 163
SetI ASST 6 cut(s) 40, 75, 109, 196, 219, 227
SgeI CNNG 8 cut(s) 25, 63, 123, 127, 178, 212, 222, 226
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 3 cut(s) 62, 128, 185
SspMI CTAG 3 cut(s) 111, 200, 250
TaaI ACNGT 1 cut(s) 86
TasI AATT 3 cut(s) 62, 128, 185
TscAI CASTG 2 cut(s) 91, 214
TseFI GTSAC 2 cut(s) 86, 202
TseI GCWGC 1 cut(s) 162
Tsp45I GTSAC 2 cut(s) 86, 202
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 2 cut(s) 91, 214
XapI RAATTY 1 cut(s) 185
XspI CTAG 3 cut(s) 111, 200, 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.