RchiOBHm_Chr3g0491421

Tropinone reductase homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
38157201 .. 38157437
237 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGTGGAATCTCCTTACTACCTTAATTTGTCAACTTGCACATCCTCTCTTAAAGGTCTCAGGCAACGGAAGCATTGTATTCATCGCCTCCATCGCTGGTATGAAAGCTCTGCCTAGATTATCTTCCTATGGAGCAACAAAAAGCACCGTTATTCAAATTTCGAAGAATTTGGCATGTGAATGGGCACAGGACAATATTCAAGCATACACTGGAGCACCTGTTTATACCCAATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.45

Weight (kDa)

9.1

Isoelectric Point (pI)

12.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
adh_short_C2 PF13561 7 - 70 1e-10 Enoyl-(Acyl carrier protein) reductase
adh_short PF00106 8 - 76 4e-14 short chain dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 156, 166
AgsI TTSAA 2 cut(s) 155, 200
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw21I GWGCWC 1 cut(s) 217
Alw26I GTCTC 1 cut(s) 61
ApoI RAATTY 2 cut(s) 156, 166
AsuII TTCGAA 1 cut(s) 161
BaeGI GKGCMC 1 cut(s) 187
Bbv12I GWGCWC 1 cut(s) 217
BccI CCATC 1 cut(s) 98
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 114
BpmI CTGGAG 1 cut(s) 231
Bpu14I TTCGAA 1 cut(s) 161
BsaI GGTCTC 1 cut(s) 61
BsaXI ACNNNNNCTCC 2 cut(s) 204, 234
Bse1I ACTGG 1 cut(s) 214
BseGI GGATG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 214
BseSI GKGCMC 1 cut(s) 187
BsiHKAI GWGCWC 1 cut(s) 217
BsmAI GTCTC 1 cut(s) 61
Bso31I GGTCTC 1 cut(s) 61
Bsp119I TTCGAA 1 cut(s) 161
Bsp1286I GDGCHC 2 cut(s) 187, 217
BspCNI CTCAG 1 cut(s) 71
BspT104I TTCGAA 1 cut(s) 161
BspTNI GGTCTC 1 cut(s) 61
BsrI ACTGG 1 cut(s) 214
Bst4CI ACNGT 1 cut(s) 148
BstBI TTCGAA 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 58
BstF5I GGATG 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 61
BstMWI GCNNNNNNNGC 2 cut(s) 69, 92
BstNSI RCATGY 1 cut(s) 177
BstSLI GKGCMC 1 cut(s) 187
BtgZI GCGATG 2 cut(s) 67, 76
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 207
CviAII CATG 1 cut(s) 174
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DdeI CTNAG 1 cut(s) 58
Eco31I GGTCTC 1 cut(s) 61
FaeI CATG 1 cut(s) 177
FaiI YATR 5 cut(s) 101, 129, 175, 205, 225
FatI CATG 1 cut(s) 173
FokI GGATG 1 cut(s) 27
FspBI CTAG 1 cut(s) 114
GsuI CTGGAG 1 cut(s) 231
Hin1II CATG 1 cut(s) 177
HincII GTYRAC 1 cut(s) 32
HindII GTYRAC 1 cut(s) 32
HinfI GANTC 1 cut(s) 7
Hpy166II GTNNAC 1 cut(s) 32
Hpy8I GTNNAC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 69, 92
HpyF3I CTNAG 1 cut(s) 58
Hsp92II CATG 1 cut(s) 177
LmnI GCTCC 2 cut(s) 131, 212
LpnPI CCDG 5 cut(s) 45, 81, 173, 195, 231
MaeI CTAG 1 cut(s) 114
MboII GAAGA 2 cut(s) 114, 175
MhlI GDGCHC 2 cut(s) 187, 217
MluCI AATT 3 cut(s) 24, 156, 166
MnlI CCTC 2 cut(s) 54, 97
MseI TTAA 2 cut(s) 23, 50
MslI CAYNNNNRTG 1 cut(s) 178
MwoI GCNNNNNNNGC 2 cut(s) 69, 92
NlaIII CATG 1 cut(s) 177
NspI RCATGY 1 cut(s) 177
NspV TTCGAA 1 cut(s) 161
PfeI GAWTC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 178
SaqAI TTAA 2 cut(s) 23, 50
SduI GDGCHC 2 cut(s) 187, 217
SetI ASST 4 cut(s) 23, 57, 109, 220
SfuI TTCGAA 1 cut(s) 161
SgeI CNNG 9 cut(s) 47, 72, 108, 126, 186, 200, 212, 222, 230
SmiMI CAYNNNNRTG 1 cut(s) 178
Sse9I AATT 3 cut(s) 24, 156, 166
SspI AATATT 2 cut(s) 196, 233
SspMI CTAG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 161
TasI AATT 3 cut(s) 24, 156, 166
TfiI GAWTC 1 cut(s) 7
Tru1I TTAA 2 cut(s) 23, 50
Tru9I TTAA 2 cut(s) 23, 50
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 70, 116
TspGWI ACGGA 1 cut(s) 81
TspRI CASTG 1 cut(s) 214
XapI RAATTY 2 cut(s) 156, 166
XceI RCATGY 1 cut(s) 177
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.