Rh7AG357500

Tropinone reductase homolog At1g07440-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0008147
Physical Location & Seq
Forward (+)
45849142 .. 45849518
377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG357500.1

Sequence Viewer

Length: 204 bp
ATGGCTGAAGATGTTCTCAGTAACCAAAGGTTGCTTGAGGCTATTAACTCTCGAACACCTTTACAACGCCCTGGCGAGCCGGAAGAGGTTTCTTCCTTGGTGGCGTTTCTGTGCTTGCCTGCTGCCTCATACATAACTGGGCAGACTATTTGCATTGACGGAGGGATGACTGTTAATGGCATAAGCTTATGCTTTCAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00960 ko01100 ko01110 map00960 map01100 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

67

Amino Acids

7.19

Weight (kDa)

4.23

Isoelectric Point (pI)

44.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
adh_short_C2 PF13561 2 - 57 2.4e-14 Enoyl-(Acyl carrier protein) reductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 27
AgsI TTSAA 1 cut(s) 197
AjnI CCWGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 186
AluI AGCT 1 cut(s) 186
ApeKI GCWGC 1 cut(s) 122
Asp700I GAANNNNTTC 1 cut(s) 12
BbvI GCAGC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 72
BfaI CTAG 1 cut(s) 202
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 72
BmrI ACTGGG 1 cut(s) 147
BmuI ACTGGG 1 cut(s) 147
BpuEI CTTGAG 1 cut(s) 56
BsaJI CCNNGG 2 cut(s) 70, 96
Bse1I ACTGG 1 cut(s) 142
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 2 cut(s) 70, 96
BseGI GGATG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 31
BseNI ACTGG 1 cut(s) 142
BseXI GCAGC 1 cut(s) 109
BsiSI CCGG 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 30
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 2 cut(s) 70, 96
BssT1I CCWWGG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 172
Bst6I CTCTTC 1 cut(s) 78
BstC8I GCNNGC 3 cut(s) 77, 116, 120
BstDEI CTNAG 1 cut(s) 17
BstF5I GGATG 1 cut(s) 171
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstV1I GCAGC 1 cut(s) 109
BtsCI GGATG 1 cut(s) 171
Cac8I GCNNGC 3 cut(s) 77, 116, 120
CviJI RGCY 4 cut(s) 5, 41, 79, 186
CviKI_1 RGCY 4 cut(s) 5, 41, 79, 186
DdeI CTNAG 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 96
ErhI CCWWGG 1 cut(s) 96
FaiI YATR 4 cut(s) 130, 134, 182, 190
Fnu4HI GCNGC 1 cut(s) 123
FokI GGATG 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 123
FspBI CTAG 1 cut(s) 202
GluI GCNGC 1 cut(s) 123
HapII CCGG 1 cut(s) 80
HindIII AAGCTT 1 cut(s) 184
HpaII CCGG 1 cut(s) 80
Hpy188III TCNNGA 2 cut(s) 51, 197
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 153
HpyF3I CTNAG 1 cut(s) 17
LpnPI CCDG 5 cut(s) 57, 84, 93, 123, 132
Lsp1109I GCAGC 1 cut(s) 109
MaeI CTAG 1 cut(s) 202
MaeIII GTNAC 1 cut(s) 20
MboII GAAGA 3 cut(s) 20, 84, 95
MnlI CCTC 4 cut(s) 31, 79, 136, 155
MroXI GAANNNNTTC 1 cut(s) 12
MseI TTAA 2 cut(s) 45, 174
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
PdmI GAANNNNTTC 1 cut(s) 12
PkrI GCNGC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
SaqAI TTAA 2 cut(s) 45, 174
SatI GCNGC 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 72
SetI ASST 4 cut(s) 32, 61, 90, 188
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
SspMI CTAG 1 cut(s) 202
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 172
TaqI TCGA 1 cut(s) 52
Tru1I TTAA 2 cut(s) 45, 174
Tru9I TTAA 2 cut(s) 45, 174
TseI GCWGC 1 cut(s) 122
TspGWI ACGGA 1 cut(s) 174
XmnI GAANNNNTTC 1 cut(s) 12
XspI CTAG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.