RchiOBHm_Chr2g0170491

Clathrin interactor EPSIN

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
84451293 .. 84451817
525 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGACTTACTTGGTTCCCTGTTATCGGTCATTGTTTCTTGTACATATATTACTACCATATCTGAAGTTGATGGCCTTATAAATTCTGCTTCAGTGACTTCATTTATGGCAACTCCTCCAGATACTACTATGTTGAACTATAGGCAGGTCTCTTATCCTCTGAAGCTATGCCAATCACTGCCACTCATTCCTCCTGGTTGA

Protein Analysis

66

Amino Acids

7.08

Weight (kDa)

4.23

Isoelectric Point (pI)

28.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 80
Acc36I ACCTGC 1 cut(s) 136
AcsI RAATTY 1 cut(s) 82
AcuI CTGAAG 3 cut(s) 75, 84, 182
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 1 cut(s) 136
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Alw26I GTCTC 1 cut(s) 154
AoxI GGCC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 82
BccI CCATC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 195
BcoDI GTCTC 1 cut(s) 154
BfmI CTRYAG 1 cut(s) 139
BfuAI ACCTGC 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 195
BmiI GGNNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 195
BpmI CTGGAG 1 cut(s) 102
BsaI GGTCTC 1 cut(s) 154
Bsc4I CCNNNNNNNGG 1 cut(s) 25
BseBI CCWGG 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 25
BseRI GAGGAG 1 cut(s) 105
BshFI GGCC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 154
BsnI GGCC 1 cut(s) 75
Bso31I GGTCTC 1 cut(s) 154
Bsp1407I TGTACA 1 cut(s) 41
BspANI GGCC 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 16
BspMI ACCTGC 1 cut(s) 136
BspTNI GGTCTC 1 cut(s) 154
BsrGI TGTACA 1 cut(s) 41
Bst2UI CCWGG 1 cut(s) 195
BstAUI TGTACA 1 cut(s) 41
BstMAI GTCTC 1 cut(s) 154
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 139
BsuRI GGCC 1 cut(s) 75
BtsI GCAGTG 1 cut(s) 176
BtsIMutI CAGTG 2 cut(s) 99, 176
BveI ACCTGC 1 cut(s) 136
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 2 cut(s) 75, 166
CviKI_1 RGCY 2 cut(s) 75, 166
CviQI GTAC 1 cut(s) 42
Eco31I GGTCTC 1 cut(s) 154
Eco57I CTGAAG 3 cut(s) 75, 84, 182
EcoRII CCWGG 1 cut(s) 193
FaiI YATR 8 cut(s) 46, 48, 59, 80, 107, 131, 141, 169
GsuI CTGGAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 75
Hpy188I TCNGA 2 cut(s) 64, 162
Hpy188III TCNNGA 1 cut(s) 119
LpnPI CCDG 4 cut(s) 32, 131, 132, 180
MaeIII GTNAC 1 cut(s) 94
MluCI AATT 1 cut(s) 82
MnlI CCTC 3 cut(s) 126, 168, 201
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NlaIV GGNNCC 1 cut(s) 16
NmuCI GTSAC 1 cut(s) 94
PsiI TTATAA 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspN4I GGNNCC 1 cut(s) 16
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 195
SetI ASST 2 cut(s) 150, 168
SfcI CTRYAG 1 cut(s) 139
SgeI CNNG 5 cut(s) 23, 31, 51, 131, 158
Sse9I AATT 1 cut(s) 82
StyD4I CCNGG 1 cut(s) 193
TaqII GACCGA 1 cut(s) 16
TasI AATT 1 cut(s) 82
TatI WGTACW 1 cut(s) 41
TscAI CASTG 2 cut(s) 99, 183
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 90
TspRI CASTG 2 cut(s) 99, 183
XapI RAATTY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.