Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006060.1

Orthogroup ID

OG0016442

Physical Location & Seq

Genomic Coordinates Forward (+)

18186 .. 19616

Gene Structure 1431 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006060.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 897 bp

atgcaactccaaacaaaactgtatgcaatccagaaaggtaatgatactatagataagtattttcagcgtatcaaggacattactgatcaattagcttctgttggcattcatattcccgaggaagagattattatcattgttgtcaatggccttccctctaagtacctaactttcaaaatcttgatcaaagctcagattacaactatgacaatgattaaatttcgttctcttttacttgatgaggagtctactatggatcaatctatgaagactgtgccgaatggaatgcctactagtaatccagttttaaatcaaggaatgcaatggaatggtgctaatattggtagtatggtgtctcctgctgtttttgttgctcaaaatgtagggggaagtcacatgttctacaatggagggatgcagcaacataatttgagcattggaacaagttattcacatccaaatggttactatcccaaacatcagcaacttgcttcaaactacaaaggaaatgtctcactgtataatggtattggcttcttcctacagcaacaaaatggtggaaacaagaactacagttcacaaggatgtgtatctcaattacctgacatttcaaatcaaggctttggtggctccatttgcaacaaacttggacatgatcactcggcatctgtgccacctaattcaaacaatgctgcaatagacttacttggttccctgttatcggccattgtgccaagtgcatctactactaccacatttgaagatgatggcattgtaaattctgctccagtgactacatttatggcaactcctccagatactactatgttgaactgtaggcatgcctcttatcctctgaagctatgccaatcactgccactcattcctcctggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HTH_21 rve

Protein Analysis

298

Amino Acids

32.26

Weight (kDa)

6.69

Isoelectric Point (pI)

38.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016442)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0170491 RchiOBHm_Chr5g0032581
rosa_multiflora	Rmu_co8201532.1_g000001 Rmu_sc0000172.1_g000014 Rmu_sc0001861.1_g000061 Rmu_sc0004465.1_g000038 Rmu_sc0006060.1_g000003 Rmu_sc0006908.1_g000022 Rmu_sc0007729.1_g000002 Rmu_sc0009395.1_g000006 Rmu_sc0036590.1_g000001 Rmu_sc0037133.1_g000001 Rmu_ssc0000417.1_g000004 Rmu_ssc0000436.1_g000006
rosa_samantha	Rh5CG142000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	248
AclWI	GGATC	1 cut(s)	264
AcoI	YGGCCR	1 cut(s)	723
AcsI	RAATTY	2 cut(s)	218, 778
AcuI	CTGAAG	1 cut(s)	878
AfaI	GTAC	1 cut(s)	164
AfiI	CCNNNNNNNGG	1 cut(s)	721
AflIII	ACRYGT	1 cut(s)	396
AgsI	TTSAA	6 cut(s)	175, 495, 612, 684, 761, 832
AhlI	ACTAGT	1 cut(s)	293
AjnI	CCWGG	1 cut(s)	889
AluBI	AGCT	3 cut(s)	95, 191, 862
AluI	AGCT	3 cut(s)	95, 191, 862
Alw26I	GTCTC	2 cut(s)	360, 517
AlwI	GGATC	1 cut(s)	264
Ama87I	CYCGRG	1 cut(s)	116
AoxI	GGCC	2 cut(s)	148, 723
ApeKI	GCWGC	2 cut(s)	418, 692
ApoI	RAATTY	2 cut(s)	218, 778
ArsI	GACNNNNNNTTYG	2 cut(s)	495, 527
AvaI	CYCGRG	1 cut(s)	116
BbsI	GAAGAC	1 cut(s)	275
BbvI	GCAGC	2 cut(s)	430, 679
BccI	CCATC	1 cut(s)	761
BcgI	CGANNNNNNTGC	2 cut(s)	268, 302
BciT130I	CCWGG	1 cut(s)	891
BclI	TGATCA	3 cut(s)	85, 183, 655
BcoDI	GTCTC	2 cut(s)	360, 517
BcuI	ACTAGT	1 cut(s)	293
BfaI	CTAG	1 cut(s)	294
BfmI	CTRYAG	4 cut(s)	48, 542, 571, 835
BisI	GCNGC	2 cut(s)	419, 693
BlsI	GCNGC	2 cut(s)	420, 694
Bme1390I	CCNGG	1 cut(s)	891
BmeT110I	CYCGRG	1 cut(s)	116
BmiI	GGNNCC	2 cut(s)	631, 712
BmrFI	CCNGG	1 cut(s)	891
BmsI	GCATC	3 cut(s)	405, 674, 749
BpiI	GAAGAC	1 cut(s)	275
BpmI	CTGGAG	2 cut(s)	771, 798
BsaBI	GATNNNNATC	2 cut(s)	131, 589
BsaJI	CCNNGG	1 cut(s)	117
Bsc4I	CCNNNNNNNGG	1 cut(s)	721
Bse1I	ACTGG	2 cut(s)	302, 788
Bse3DI	GCAATG	1 cut(s)	329
Bse8I	GATNNNNATC	2 cut(s)	131, 589
BseBI	CCWGG	1 cut(s)	891
BseDI	CCNNGG	1 cut(s)	117
BseGI	GGATG	3 cut(s)	420, 454, 590
BseJI	GATNNNNATC	2 cut(s)	131, 589
BseLI	CCNNNNNNNGG	1 cut(s)	721
BseMI	GCAATG	1 cut(s)	329
BseMII	CTCAG	1 cut(s)	206
BseNI	ACTGG	2 cut(s)	302, 788
BseRI	GAGGAG	2 cut(s)	257, 801
BseXI	GCAGC	2 cut(s)	430, 679
BshFI	GGCC	2 cut(s)	150, 725
BsiHKCI	CYCGRG	1 cut(s)	116
BslI	CCNNNNNNNGG	1 cut(s)	721
BsmAI	GTCTC	2 cut(s)	360, 517
BsmI	GAATGC	3 cut(s)	105, 291, 324
BsnI	GGCC	2 cut(s)	150, 725
BsoBI	CYCGRG	1 cut(s)	116
Bsp143I	GATC	4 cut(s)	85, 183, 256, 655
BspANI	GGCC	2 cut(s)	150, 725
BspCNI	CTCAG	1 cut(s)	205
BspLI	GGNNCC	2 cut(s)	631, 712
BspPI	GGATC	1 cut(s)	264
BsrDI	GCAATG	1 cut(s)	329
BsrI	ACTGG	2 cut(s)	302, 788
BssECI	CCNNGG	1 cut(s)	117
BssMI	GATC	4 cut(s)	85, 183, 256, 655
Bst2UI	CCWGG	1 cut(s)	891
Bst4CI	ACNGT	5 cut(s)	21, 274, 519, 575, 836
Bst6I	CTCTTC	1 cut(s)	117
BstC8I	GCNNGC	1 cut(s)	843
BstDEI	CTNAG	2 cut(s)	159, 192
BstF5I	GGATG	3 cut(s)	420, 454, 590
BstKTI	GATC	4 cut(s)	88, 186, 259, 658
BstMAI	GTCTC	2 cut(s)	360, 517
BstMBI	GATC	4 cut(s)	85, 183, 256, 655
BstMWI	GCNNNNNNNGC	2 cut(s)	627, 636
BstNI	CCWGG	1 cut(s)	891
BstNSI	RCATGY	2 cut(s)	400, 845
BstSCI	CCNGG	1 cut(s)	889
BstSFI	CTRYAG	4 cut(s)	48, 542, 571, 835
BstV1I	GCAGC	2 cut(s)	430, 679
BstV2I	GAAGAC	1 cut(s)	275
BsuRI	GGCC	2 cut(s)	150, 725
BtsCI	GGATG	3 cut(s)	420, 454, 590
BtsI	GCAGTG	1 cut(s)	872
BtsIMutI	CAGTG	3 cut(s)	515, 795, 872
Cac8I	GCNNGC	1 cut(s)	843
Csp6I	GTAC	1 cut(s)	163
CviAII	CATG	3 cut(s)	397, 653, 842
CviJI	RGCY	8 cut(s)	95, 150, 191, 534, 621, 630, 725, 862
CviKI_1	RGCY	8 cut(s)	95, 150, 191, 534, 621, 630, 725, 862
CviQI	GTAC	1 cut(s)	163
DdeI	CTNAG	2 cut(s)	159, 192
DpnI	GATC	4 cut(s)	87, 185, 258, 657
DpnII	GATC	4 cut(s)	85, 183, 256, 655
DraI	TTTAAA	1 cut(s)	309
EaeI	YGGCCR	1 cut(s)	723
Eam1104I	CTCTTC	1 cut(s)	117
EarI	CTCTTC	1 cut(s)	117
Eco57I	CTGAAG	1 cut(s)	878
Eco88I	CYCGRG	1 cut(s)	116
EcoRII	CCWGG	1 cut(s)	889
FaeI	CATG	3 cut(s)	400, 656, 845
FatI	CATG	3 cut(s)	396, 652, 841
FbaI	TGATCA	3 cut(s)	85, 183, 655
FblI	GTMKAC	1 cut(s)	248
Fnu4HI	GCNGC	2 cut(s)	419, 693
FokI	GGATG	3 cut(s)	427, 441, 597
Fsp4HI	GCNGC	2 cut(s)	419, 693
FspBI	CTAG	1 cut(s)	294
GluI	GCNGC	2 cut(s)	419, 693
GsuI	CTGGAG	2 cut(s)	771, 798
HaeIII	GGCC	2 cut(s)	150, 725
Hin1II	CATG	3 cut(s)	400, 656, 845
HinfI	GANTC	1 cut(s)	245
Hpy166II	GTNNAC	2 cut(s)	249, 578
Hpy188I	TCNGA	2 cut(s)	195, 858
Hpy188III	TCNNGA	4 cut(s)	31, 116, 181, 815
Hpy8I	GTNNAC	2 cut(s)	249, 578
HpyAV	CCTTC	1 cut(s)	161
HpyCH4III	ACNGT	5 cut(s)	21, 274, 519, 575, 836
HpyCH4V	TGCA	7 cut(s)	4, 26, 322, 418, 639, 695, 740
HpyF10VI	GCNNNNNNNGC	2 cut(s)	627, 636
HpyF3I	CTNAG	2 cut(s)	159, 192
Hsp92II	CATG	3 cut(s)	400, 656, 845
Ksp22I	TGATCA	3 cut(s)	85, 183, 655
Kzo9I	GATC	4 cut(s)	85, 183, 256, 655
LmnI	GCTCC	2 cut(s)	635, 790
LpnPI	CCDG	8 cut(s)	44, 315, 372, 615, 728, 801, 828, 876
Lsp1109I	GCAGC	2 cut(s)	430, 679
LweI	GCATC	3 cut(s)	405, 674, 749
MaeI	CTAG	1 cut(s)	294
MaeIII	GTNAC	3 cut(s)	392, 464, 790
MalI	GATC	4 cut(s)	87, 185, 258, 657
MboI	GATC	4 cut(s)	85, 183, 256, 655
MboII	GAAGA	4 cut(s)	134, 280, 529, 773
MluCI	AATT	6 cut(s)	89, 218, 427, 596, 679, 778
MlyI	GAGTC	1 cut(s)	254
MnlI	CCTC	8 cut(s)	112, 166, 235, 404, 822, 856, 864, 897
MseI	TTAA	2 cut(s)	216, 308
MslI	CAYNNNNRTG	2 cut(s)	459, 583
MspR9I	CCNGG	1 cut(s)	891
Mva1269I	GAATGC	3 cut(s)	105, 291, 324
MvaI	CCWGG	1 cut(s)	891
MwoI	GCNNNNNNNGC	2 cut(s)	627, 636
NdeII	GATC	4 cut(s)	85, 183, 256, 655
NlaIII	CATG	3 cut(s)	400, 656, 845
NlaIV	GGNNCC	2 cut(s)	631, 712
NmeAIII	GCCGAG	1 cut(s)	641
NmuCI	GTSAC	2 cut(s)	392, 790
NspI	RCATGY	2 cut(s)	400, 845
PaeI	GCATGC	1 cut(s)	845
PciI	ACATGT	1 cut(s)	396
PctI	GAATGC	3 cut(s)	105, 291, 324
PfoI	TCCNGGA	1 cut(s)	889
PkrI	GCNGC	2 cut(s)	420, 694
PleI	GAGTC	1 cut(s)	253
PpsI	GAGTC	1 cut(s)	253
PscI	ACATGT	1 cut(s)	396
Psp6I	CCWGG	1 cut(s)	889
PspGI	CCWGG	1 cut(s)	889
PspN4I	GGNNCC	2 cut(s)	631, 712
RsaI	GTAC	1 cut(s)	164
RsaNI	GTAC	1 cut(s)	163
RseI	CAYNNNNRTG	2 cut(s)	459, 583
SaqAI	TTAA	2 cut(s)	216, 308
SatI	GCNGC	2 cut(s)	419, 693
Sau3AI	GATC	4 cut(s)	85, 183, 256, 655
SchI	GAGTC	1 cut(s)	254
ScrFI	CCNGG	1 cut(s)	891
SetI	ASST	7 cut(s)	40, 97, 168, 193, 604, 679, 864
SfaNI	GCATC	3 cut(s)	405, 674, 749
SfcI	CTRYAG	4 cut(s)	48, 542, 571, 835
SmiMI	CAYNNNNRTG	2 cut(s)	459, 583
SpeI	ACTAGT	1 cut(s)	293
SphI	GCATGC	1 cut(s)	845
Sse9I	AATT	6 cut(s)	89, 218, 427, 596, 679, 778
SspI	AATATT	1 cut(s)	340
SspMI	CTAG	1 cut(s)	294
StyD4I	CCNGG	1 cut(s)	889
TaaI	ACNGT	5 cut(s)	21, 274, 519, 575, 836
TasI	AATT	6 cut(s)	89, 218, 427, 596, 679, 778
Tru1I	TTAA	2 cut(s)	216, 308
Tru9I	TTAA	2 cut(s)	216, 308
TscAI	CASTG	3 cut(s)	522, 795, 879
TseFI	GTSAC	2 cut(s)	392, 790
TseI	GCWGC	2 cut(s)	418, 692
Tsp45I	GTSAC	2 cut(s)	392, 790
TspDTI	ATGAA	2 cut(s)	98, 281
TspRI	CASTG	3 cut(s)	522, 795, 879
XapI	RAATTY	2 cut(s)	218, 778
XceI	RCATGY	2 cut(s)	400, 845
XmiI	GTMKAC	1 cut(s)	248
XspI	CTAG	1 cut(s)	294

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.