RchiOBHm_Chr1g0323671

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
11120932 .. 11121300
369 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 369 bp
ATGGATAGGCTAAAGAACACACCACATAGACGCATTATTGAGGTGCTTCGGATTAGTTTTGATGGACTGGAGGAAAAAGACAGAGAAATATTCCTACATATTGCTTGCTTTTACAAGGGGAAGGATAAGGATCGTGTGACACAAATACTAGACTATTGCCAGCTAAACCCTGTCATTGGTTTAAGTGTTCTTGCTGATAGATCTCTCATAACTATCTCCAACAACGAACTGTCAATGCATGATTTGCTACAAGAAATGGGCTGGGAAATTGTTCGTGAACAGTCTCCTACATATCCAGGCAAACGTAGTAGATTATGGTCTCATGAAGACATCAACAATGTGCTGGAGAGTGATAAGGTAAGAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

14.35

Weight (kDa)

6.08

Isoelectric Point (pI)

64.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_ROQ1 PF23282 24 - 95 2.6e-24 Disease resistance protein Roq1-like, winged-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 176
AjnI CCWGG 1 cut(s) 295
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
Alw26I GTCTC 2 cut(s) 288, 324
AlwI GGATC 1 cut(s) 138
Asp700I GAANNNNTTC 1 cut(s) 270
BbsI GAAGAC 1 cut(s) 333
BccI CCATC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 297
BcoDI GTCTC 2 cut(s) 288, 324
BfaI CTAG 1 cut(s) 149
BglII AGATCT 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 297
BmrFI CCNGG 1 cut(s) 297
BpiI GAAGAC 1 cut(s) 333
BpmI CTGGAG 2 cut(s) 89, 365
BsaBI GATNNNNATC 1 cut(s) 129
BsaI GGTCTC 1 cut(s) 324
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse1I ACTGG 1 cut(s) 72
Bse8I GATNNNNATC 1 cut(s) 129
BseBI CCWGG 1 cut(s) 297
BseJI GATNNNNATC 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 176
BseNI ACTGG 1 cut(s) 72
BseYI CCCAGC 1 cut(s) 261
BslI CCNNNNNNNGG 1 cut(s) 176
BsmAI GTCTC 2 cut(s) 288, 324
Bso31I GGTCTC 1 cut(s) 324
Bsp143I GATC 2 cut(s) 130, 200
BspHI TCATGA 1 cut(s) 322
BspPI GGATC 1 cut(s) 138
BspTNI GGTCTC 1 cut(s) 324
BsrI ACTGG 1 cut(s) 72
BssMI GATC 2 cut(s) 130, 200
Bst2UI CCWGG 1 cut(s) 297
Bst4CI ACNGT 2 cut(s) 231, 282
BstAPI GCANNNNNTGC 1 cut(s) 244
BstC8I GCNNGC 2 cut(s) 106, 161
BstKTI GATC 2 cut(s) 133, 203
BstMAI GTCTC 2 cut(s) 288, 324
BstMBI GATC 2 cut(s) 130, 200
BstMWI GCNNNNNNNGC 1 cut(s) 244
BstNI CCWGG 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 295
BstV2I GAAGAC 1 cut(s) 333
BstX2I RGATCY 1 cut(s) 200
BstYI RGATCY 1 cut(s) 200
Cac8I GCNNGC 2 cut(s) 106, 161
CciI TCATGA 1 cut(s) 322
CseI GACGC 1 cut(s) 39
CviAII CATG 2 cut(s) 239, 323
CviJI RGCY 3 cut(s) 10, 163, 261
CviKI_1 RGCY 3 cut(s) 10, 163, 261
DpnI GATC 2 cut(s) 132, 202
DpnII GATC 2 cut(s) 130, 200
Eco31I GGTCTC 1 cut(s) 324
EcoRII CCWGG 1 cut(s) 295
EcoT22I ATGCAT 1 cut(s) 240
FaeI CATG 2 cut(s) 242, 326
FaiI YATR 7 cut(s) 27, 99, 209, 240, 292, 316, 324
FatI CATG 2 cut(s) 238, 322
FspBI CTAG 1 cut(s) 149
GsaI CCCAGC 1 cut(s) 265
GsuI CTGGAG 2 cut(s) 89, 365
HgaI GACGC 1 cut(s) 39
Hin1II CATG 2 cut(s) 242, 326
Hpy166II GTNNAC 1 cut(s) 278
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 2 cut(s) 275, 323
Hpy8I GTNNAC 1 cut(s) 278
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 231, 282
HpyCH4IV ACGT 1 cut(s) 304
HpyCH4V TGCA 1 cut(s) 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 244
HpySE526I ACGT 1 cut(s) 304
Hsp92II CATG 2 cut(s) 242, 326
Kzo9I GATC 2 cut(s) 130, 200
LpnPI CCDG 7 cut(s) 53, 173, 183, 247, 282, 309, 329
MaeI CTAG 1 cut(s) 149
MaeII ACGT 1 cut(s) 304
MaeIII GTNAC 1 cut(s) 136
MalI GATC 2 cut(s) 132, 202
MboI GATC 2 cut(s) 130, 200
MboII GAAGA 1 cut(s) 338
MflI RGATCY 1 cut(s) 200
MluCI AATT 1 cut(s) 267
MmeI TCCRAC 1 cut(s) 243
MnlI CCTC 2 cut(s) 34, 64
Mph1103I ATGCAT 1 cut(s) 240
MroXI GAANNNNTTC 1 cut(s) 270
MseI TTAA 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 297
MvaI CCWGG 1 cut(s) 297
MwoI GCNNNNNNNGC 1 cut(s) 244
NdeII GATC 2 cut(s) 130, 200
NlaIII CATG 2 cut(s) 242, 326
NmuCI GTSAC 1 cut(s) 136
NsiI ATGCAT 1 cut(s) 240
PagI TCATGA 1 cut(s) 322
PdmI GAANNNNTTC 1 cut(s) 270
Psp6I CCWGG 1 cut(s) 295
PspFI CCCAGC 1 cut(s) 261
PspGI CCWGG 1 cut(s) 295
PsuI RGATCY 1 cut(s) 200
SaqAI TTAA 1 cut(s) 182
Sau3AI GATC 2 cut(s) 130, 200
ScrFI CCNGG 1 cut(s) 297
SetI ASST 4 cut(s) 45, 165, 307, 360
Sse9I AATT 1 cut(s) 267
SspI AATATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 295
TaaI ACNGT 2 cut(s) 231, 282
TaiI ACGT 1 cut(s) 307
TasI AATT 1 cut(s) 267
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TseFI GTSAC 1 cut(s) 136
Tsp45I GTSAC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 339
XmnI GAANNNNTTC 1 cut(s) 270
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.