RchiOBHm_Chr1g0363771

Belongs to the tetraspanin (TM4SF) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
55081631 .. 55082409
779 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGCAAGGAGCAGTACAACATGTGAAAGCTTCCTCCAAACCCCACTCTTAGTGATTGGCTTTGTTGTGCTAATCATATCTCTGGCTGGGTTCATTGGTGCTTGTTTCAATGTTGCTTGGCCGCTTTGGGTGTACTTAGTAGTCATGCTTTTCCTTATTGCAACCCTGATGGGGTTGACTGTGTTTGGGTTTGTGGTTACAAGTCAAGGTGCTGGAGTTGATGTGCCTGGTAGGGCATATAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.69

Weight (kDa)

7.8

Isoelectric Point (pI)

31.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tetraspanin PF00335 4 - 69 2.8e-13 Tetraspanin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 122
AcoI YGGCCR 1 cut(s) 119
AfaI GTAC 2 cut(s) 16, 134
AfiI CCNNNNNNNGG 1 cut(s) 171
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 109
AjnI CCWGG 1 cut(s) 226
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
AoxI GGCC 1 cut(s) 119
BccI CCATC 1 cut(s) 163
BciT130I CCWGG 1 cut(s) 228
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 228
BmrFI CCNGG 1 cut(s) 228
BpmI CTGGAG 1 cut(s) 234
BsaXI ACNNNNNCTCC 2 cut(s) 207, 237
Bsc4I CCNNNNNNNGG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 228
BseLI CCNNNNNNNGG 1 cut(s) 171
BseYI CCCAGC 1 cut(s) 86
BshFI GGCC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 171
BsnI GGCC 1 cut(s) 121
BspACI CCGC 1 cut(s) 122
BspANI GGCC 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 228
Bst4CI ACNGT 1 cut(s) 181
BstDEI CTNAG 2 cut(s) 49, 136
BstNI CCWGG 1 cut(s) 228
BstNSI RCATGY 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 226
BsuRI GGCC 1 cut(s) 121
Csp6I GTAC 2 cut(s) 15, 133
CviAII CATG 2 cut(s) 21, 145
CviJI RGCY 4 cut(s) 30, 60, 86, 121
CviKI_1 RGCY 4 cut(s) 30, 60, 86, 121
CviQI GTAC 2 cut(s) 15, 133
DdeI CTNAG 2 cut(s) 49, 136
EaeI YGGCCR 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 226
FaeI CATG 2 cut(s) 24, 148
FaiI YATR 5 cut(s) 22, 77, 146, 238, 240
FatI CATG 2 cut(s) 20, 144
Fnu4HI GCNGC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 122
GsaI CCCAGC 1 cut(s) 90
GsuI CTGGAG 1 cut(s) 234
HaeIII GGCC 1 cut(s) 121
Hin1II CATG 2 cut(s) 24, 148
HincII GTYRAC 1 cut(s) 177
HindII GTYRAC 1 cut(s) 177
HindIII AAGCTT 1 cut(s) 28
Hpy166II GTNNAC 2 cut(s) 133, 177
Hpy8I GTNNAC 2 cut(s) 133, 177
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 161
HpyF3I CTNAG 2 cut(s) 49, 136
Hsp92II CATG 2 cut(s) 24, 148
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 6 cut(s) 68, 72, 179, 198, 213, 240
MaeIII GTNAC 1 cut(s) 196
MnlI CCTC 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 228
MvaI CCWGG 1 cut(s) 228
NlaIII CATG 2 cut(s) 24, 148
NspI RCATGY 1 cut(s) 24
PciI ACATGT 1 cut(s) 20
PkrI GCNGC 1 cut(s) 123
PscI ACATGT 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 226
PspFI CCCAGC 1 cut(s) 86
PspGI CCWGG 1 cut(s) 226
RsaI GTAC 2 cut(s) 16, 134
RsaNI GTAC 2 cut(s) 15, 133
SatI GCNGC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 228
SetI ASST 2 cut(s) 32, 211
SsiI CCGC 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 226
TaaI ACNGT 1 cut(s) 181
TatI WGTACW 2 cut(s) 14, 132
TauI GCSGC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 82
XceI RCATGY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.