RchiOBHm_Chr1g0374621

Endoglucanase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
62384484 .. 62384833
350 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGAAAGCTGCAAGAAAATTTGTAAATTGTGGGAACAATGTTGTTGTCACTCCAGCAAGGCTGGTAGAACTCACAAAAGGACAGGTTGATTATGTACTGGGAAGAAATCCTAATAGCATGTCATACATGGTGGGATATGGTACAAGATTTCCCCAGAAGATACCTCACCACGGATCAGTGATACCTTTGATTGATCAACACCCCAAACACATGCAGTGTCATGAAGGAGACGTATTTCAAAACTCAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.25

Weight (kDa)

9.39

Isoelectric Point (pI)

17.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_9 PF00759 16 - 67 8.5e-14 Glycosyl hydrolase family 9
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017390)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 181
AcsI RAATTY 1 cut(s) 17
AfaI GTAC 2 cut(s) 96, 142
AfiI CCNNNNNNNGG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 239
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 222
AlwI GGATC 1 cut(s) 181
ApeKI GCWGC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 158
BclI TGATCA 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 222
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmrI ACTGGG 1 cut(s) 107
BmuI ACTGGG 1 cut(s) 107
BpmI CTGGAG 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 169
Bsc4I CCNNNNNNNGG 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 169
BseLI CCNNNNNNNGG 1 cut(s) 170
BseNI ACTGG 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 170
BsmAI GTCTC 1 cut(s) 222
BsmBI CGTCTC 1 cut(s) 222
Bsp143I GATC 2 cut(s) 173, 193
BspHI TCATGA 1 cut(s) 220
BspPI GGATC 1 cut(s) 181
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 169
BssMI GATC 2 cut(s) 173, 193
BstDEI CTNAG 1 cut(s) 244
BstDSI CCRYGG 1 cut(s) 169
BstKTI GATC 2 cut(s) 176, 196
BstMAI GTCTC 1 cut(s) 222
BstMBI GATC 2 cut(s) 173, 193
BstNSI RCATGY 2 cut(s) 121, 214
BtgI CCRYGG 1 cut(s) 169
BtsI GCAGTG 1 cut(s) 221
BtsIMutI CAGTG 2 cut(s) 183, 221
CciI TCATGA 1 cut(s) 220
Csp6I GTAC 2 cut(s) 95, 141
CviAII CATG 4 cut(s) 118, 127, 211, 221
CviJI RGCY 3 cut(s) 8, 61, 249
CviKI_1 RGCY 3 cut(s) 8, 61, 249
CviQI GTAC 2 cut(s) 95, 141
DdeI CTNAG 1 cut(s) 244
DpnI GATC 2 cut(s) 175, 195
DpnII GATC 2 cut(s) 173, 193
Esp3I CGTCTC 1 cut(s) 222
FaeI CATG 4 cut(s) 121, 130, 214, 224
FaiI YATR 7 cut(s) 93, 119, 124, 128, 138, 212, 222
FatI CATG 4 cut(s) 117, 126, 210, 220
FbaI TGATCA 1 cut(s) 193
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
GluI GCNGC 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 36
Hin1II CATG 4 cut(s) 121, 130, 214, 224
HphI GGTGA 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 221
HpyAV CCTTC 1 cut(s) 218
HpyCH4IV ACGT 1 cut(s) 231
HpyCH4V TGCA 2 cut(s) 11, 214
HpyF3I CTNAG 1 cut(s) 244
HpySE526I ACGT 1 cut(s) 231
Hsp92II CATG 4 cut(s) 121, 130, 214, 224
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 173, 193
LpnPI CCDG 6 cut(s) 47, 66, 68, 83, 167, 231
MaeII ACGT 1 cut(s) 231
MaeIII GTNAC 1 cut(s) 46
MalI GATC 2 cut(s) 175, 195
MboI GATC 2 cut(s) 173, 193
MboII GAAGA 2 cut(s) 114, 169
MluCI AATT 2 cut(s) 17, 25
MnlI CCTC 1 cut(s) 174
NdeII GATC 2 cut(s) 173, 193
NlaIII CATG 4 cut(s) 121, 130, 214, 224
NmuCI GTSAC 1 cut(s) 46
NspI RCATGY 2 cut(s) 121, 214
PagI TCATGA 1 cut(s) 220
PkrI GCNGC 1 cut(s) 10
RsaI GTAC 2 cut(s) 96, 142
RsaNI GTAC 2 cut(s) 95, 141
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 173, 193
SetI ASST 5 cut(s) 10, 87, 166, 187, 234
Sse9I AATT 2 cut(s) 17, 25
TaiI ACGT 1 cut(s) 234
TasI AATT 2 cut(s) 17, 25
TatI WGTACW 1 cut(s) 94
TscAI CASTG 2 cut(s) 183, 221
TseFI GTSAC 1 cut(s) 46
TseI GCWGC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 2 cut(s) 17, 237
TspGWI ACGGA 1 cut(s) 186
TspRI CASTG 2 cut(s) 183, 221
XapI RAATTY 1 cut(s) 17
XceI RCATGY 2 cut(s) 121, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.