Rmu_co8499365.1_g000001

Endoglucanase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8499365.1
Physical Location & Seq
Reverse (-)
1733 .. 2259
527 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8499365.1_g000001.1.cds

Sequence Viewer

Length: 408 bp
atgtctgccacaaagcacaggtttaactgtggcaatcttgttgtcacttcaagcactttaagaaacattgccaagagacaggtggactacatattaggggtaaacccactgaacatgtcctacatggtaggttatggacctcgctatcctaagagaattcaccacagaggatcttcattgccctcattggcaagtcatccagaaaccataggttgtaaagctggtttccaaccattcttctattcatcaaatccaaatcctaacctcctagttggagctgttgttggaggtccaaatcagaatgatgggtttccagatgatcgcaccgattatagtcattcagagcctgcaacatacataaatggtgctatagtcggaccattagcatactttgcaaatctcaattga

Protein Analysis

135

Amino Acids

14.7

Weight (kDa)

9.23

Isoelectric Point (pI)

40.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017390)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 178
AcsI RAATTY 1 cut(s) 156
AflIII ACRYGT 1 cut(s) 114
AgsI TTSAA 1 cut(s) 51
AluBI AGCT 2 cut(s) 221, 278
AluI AGCT 2 cut(s) 221, 278
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 178
AlwNI CAGNNNCTG 1 cut(s) 347
ApoI RAATTY 1 cut(s) 156
AspS9I GGNCC 3 cut(s) 137, 290, 377
AsuHPI GGTGA 1 cut(s) 152
AvaII GGWCC 3 cut(s) 137, 290, 377
BccI CCATC 1 cut(s) 299
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 269
BfmI CTRYAG 1 cut(s) 369
Bme18I GGWCC 3 cut(s) 137, 290, 377
BmgT120I GGNCC 3 cut(s) 137, 290, 377
BsaXI ACNNNNNCTCC 2 cut(s) 267, 297
Bse3DI GCAATG 2 cut(s) 66, 176
BseGI GGATG 1 cut(s) 196
BseMI GCAATG 2 cut(s) 66, 176
BsmAI GTCTC 1 cut(s) 70
Bsp143I GATC 2 cut(s) 170, 319
BspPI GGATC 1 cut(s) 178
BsrDI GCAATG 2 cut(s) 66, 176
BssMI GATC 2 cut(s) 170, 319
Bst4CI ACNGT 1 cut(s) 29
BstAPI GCANNNNNTGC 1 cut(s) 392
BstC8I GCNNGC 1 cut(s) 348
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 196
BstKTI GATC 2 cut(s) 173, 322
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 2 cut(s) 170, 319
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNSI RCATGY 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 369
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
BtsCI GGATG 1 cut(s) 196
BtsIMutI CAGTG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 348
CaiI CAGNNNCTG 1 cut(s) 347
Cfr13I GGNCC 3 cut(s) 137, 290, 377
CviAII CATG 2 cut(s) 115, 124
CviJI RGCY 3 cut(s) 221, 278, 346
CviKI_1 RGCY 3 cut(s) 221, 278, 346
DdeI CTNAG 1 cut(s) 150
DpnI GATC 2 cut(s) 172, 321
DpnII GATC 2 cut(s) 170, 319
Eco47I GGWCC 3 cut(s) 137, 290, 377
EcoRI GAATTC 1 cut(s) 156
FaeI CATG 2 cut(s) 118, 127
FatI CATG 2 cut(s) 114, 123
FokI GGATG 1 cut(s) 183
FspBI CTAG 1 cut(s) 269
Hin1II CATG 2 cut(s) 118, 127
HphI GGTGA 1 cut(s) 152
Hpy166II GTNNAC 2 cut(s) 85, 103
Hpy188I TCNGA 3 cut(s) 300, 343, 377
Hpy188III TCNNGA 2 cut(s) 200, 314
Hpy8I GTNNAC 2 cut(s) 85, 103
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4V TGCA 2 cut(s) 350, 395
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 118, 127
Kzo9I GATC 2 cut(s) 170, 319
LmnI GCTCC 1 cut(s) 275
LpnPI CCDG 6 cut(s) 4, 65, 207, 213, 327, 360
MaeI CTAG 1 cut(s) 269
MaeIII GTNAC 1 cut(s) 43
MalI GATC 2 cut(s) 172, 321
MboI GATC 2 cut(s) 170, 319
MboII GAAGA 2 cut(s) 165, 229
MfeI CAATTG 1 cut(s) 403
MflI RGATCY 1 cut(s) 170
MluCI AATT 2 cut(s) 156, 403
MmeI TCCRAC 4 cut(s) 253, 253, 265, 355
MnlI CCTC 5 cut(s) 150, 161, 193, 275, 281
MseI TTAA 2 cut(s) 24, 59
MunI CAATTG 1 cut(s) 403
MwoI GCNNNNNNNGC 1 cut(s) 392
NdeII GATC 2 cut(s) 170, 319
NlaIII CATG 2 cut(s) 118, 127
NmuCI GTSAC 1 cut(s) 43
NspI RCATGY 1 cut(s) 118
PciI ACATGT 1 cut(s) 114
PscI ACATGT 1 cut(s) 114
PspPI GGNCC 3 cut(s) 137, 290, 377
PsrI GAACNNNNNNTAC 2 cut(s) 104, 136
PstNI CAGNNNCTG 1 cut(s) 347
PsuI RGATCY 1 cut(s) 170
SaqAI TTAA 2 cut(s) 24, 59
Sau3AI GATC 2 cut(s) 170, 319
Sau96I GGNCC 3 cut(s) 137, 290, 377
SetI ASST 9 cut(s) 23, 84, 133, 142, 214, 223, 267, 280, 292
SfcI CTRYAG 1 cut(s) 369
SinI GGWCC 3 cut(s) 137, 290, 377
Sse9I AATT 2 cut(s) 156, 403
SspMI CTAG 1 cut(s) 269
TaaI ACNGT 1 cut(s) 29
TasI AATT 2 cut(s) 156, 403
Tru1I TTAA 2 cut(s) 24, 59
Tru9I TTAA 2 cut(s) 24, 59
TscAI CASTG 1 cut(s) 114
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 2 cut(s) 165, 234
TspRI CASTG 1 cut(s) 114
VpaK11BI GGWCC 3 cut(s) 137, 290, 377
XapI RAATTY 1 cut(s) 156
XceI RCATGY 1 cut(s) 118
XcmI CCANNNNNNNNNTGG 1 cut(s) 79
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.