RchiOBHm_Chr1g0379621

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
65648980 .. 65651785
2806 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCTAAAGTTTCATGTGTTTGCACTTATGGACTACAATCCACATGGATTGAAGATTTCTGGTATTTACCGTTTCGGGTCAAAGTCCATGTCTTATGACCATGAGAATTTAACAGACCTGATATTAAGTTGTTGGGTATACAGTACTCAGATATTGTTAAGTATAAAATACCTAAAGCAAGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.16

Weight (kDa)

8.82

Isoelectric Point (pI)

21.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TOP6A-Spo11_Toprim PF21180 2 - 38 6.7e-07 Topoisomerase 6 subunit A/Spo11, Toprim domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 106
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 1 cut(s) 52
ApoI RAATTY 1 cut(s) 106
ArsI GACNNNNNNTTYG 2 cut(s) 74, 106
BmcAI AGTACT 1 cut(s) 145
BseMII CTCAG 1 cut(s) 161
BspCNI CTCAG 1 cut(s) 160
BssNAI GTATAC 1 cut(s) 139
Bst1107I GTATAC 1 cut(s) 139
Bst4CI ACNGT 2 cut(s) 71, 143
BstDEI CTNAG 1 cut(s) 147
BstZ17I GTATAC 1 cut(s) 139
Csp6I GTAC 1 cut(s) 144
CspCI CAANNNNNGTGG 2 cut(s) 30, 65
CviAII CATG 4 cut(s) 14, 44, 88, 101
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 147
FaeI CATG 4 cut(s) 17, 47, 91, 104
FaiI YATR 9 cut(s) 15, 29, 45, 89, 96, 102, 139, 164, 184
FatI CATG 4 cut(s) 13, 43, 87, 100
FblI GTMKAC 1 cut(s) 138
Hin1II CATG 4 cut(s) 17, 47, 91, 104
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 139
HpyCH4III ACNGT 2 cut(s) 71, 143
HpyCH4V TGCA 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 4 cut(s) 17, 47, 91, 104
LpnPI CCDG 2 cut(s) 45, 131
MboII GAAGA 1 cut(s) 64
MluCI AATT 1 cut(s) 106
MseI TTAA 3 cut(s) 110, 125, 158
NlaIII CATG 4 cut(s) 17, 47, 91, 104
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 3 cut(s) 110, 125, 158
ScaI AGTACT 1 cut(s) 145
SetI ASST 2 cut(s) 120, 174
SgeI CNNG 7 cut(s) 26, 56, 72, 88, 100, 113, 130
Sse9I AATT 1 cut(s) 106
TaaI ACNGT 2 cut(s) 71, 143
TasI AATT 1 cut(s) 106
TatI WGTACW 1 cut(s) 143
Tru1I TTAA 3 cut(s) 110, 125, 158
Tru9I TTAA 3 cut(s) 110, 125, 158
XapI RAATTY 1 cut(s) 106
XmiI GTMKAC 1 cut(s) 138
ZrmI AGTACT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.