Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0009658

Physical Location & Seq

Genomic Coordinates Forward (+)

65648980 .. 65651785

Gene Structure 2806 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ60293

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGCTAAAGTTTCATGTGTTTGCACTTATGGACTACAATCCACATGGATTGAAGATTTCTGGTATTTACCGTTTCGGGTCAAAGTCCATGTCTTATGACCATGAGAATTTAACAGACCTGATATTAAGTTGTTGGGTATACAGTACTCAGATATTGTTAAGTATAAAATACCTAAAGCAAGTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04113 map04113

Pfam Domains

Protein Families

TP6A_N

Protein Analysis

61

Amino Acids

7.16

Weight (kDa)

8.82

Isoelectric Point (pI)

21.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
TOP6A-Spo11_Toprim	PF21180	2 - 38	6.7e-07	Topoisomerase 6 subunit A/Spo11, Toprim domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009658)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g33020 FvH4_3g06060
rosa_chinensis	RchiOBHm_Chr1g0379621 RchiOBHm_Chr5g0010071 RchiOBHm_Chr6g0278391
rosa_laevigata	RLG00000013233
rosa_multiflora	Rmu_sc0002080.1_g000036 Rmu_sc0022226.1_g000003
rosa_roxburghii	Rroxscaffold_4G00280000
rosa_rugosa	Rorug01G0413600 Rorug04G0449100
rosa_samantha	Rh1AG437000 Rh1AG437300 Rh1AG437400 Rh1BG393500 Rh1CG406500 Rh1DG424400 Rh5CG087500 Rh6AG229400 Rh6CG233200 Rh7CG094900 Rh7CG095000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	138
AcsI	RAATTY	1 cut(s)	106
AfaI	GTAC	1 cut(s)	145
AgsI	TTSAA	1 cut(s)	52
ApoI	RAATTY	1 cut(s)	106
ArsI	GACNNNNNNTTYG	2 cut(s)	74, 106
BmcAI	AGTACT	1 cut(s)	145
BseMII	CTCAG	1 cut(s)	161
BspCNI	CTCAG	1 cut(s)	160
BssNAI	GTATAC	1 cut(s)	139
Bst1107I	GTATAC	1 cut(s)	139
Bst4CI	ACNGT	2 cut(s)	71, 143
BstDEI	CTNAG	1 cut(s)	147
BstZ17I	GTATAC	1 cut(s)	139
Csp6I	GTAC	1 cut(s)	144
CspCI	CAANNNNNGTGG	2 cut(s)	30, 65
CviAII	CATG	4 cut(s)	14, 44, 88, 101
CviQI	GTAC	1 cut(s)	144
DdeI	CTNAG	1 cut(s)	147
FaeI	CATG	4 cut(s)	17, 47, 91, 104
FaiI	YATR	9 cut(s)	15, 29, 45, 89, 96, 102, 139, 164, 184
FatI	CATG	4 cut(s)	13, 43, 87, 100
FblI	GTMKAC	1 cut(s)	138
Hin1II	CATG	4 cut(s)	17, 47, 91, 104
Hpy166II	GTNNAC	1 cut(s)	139
Hpy188I	TCNGA	1 cut(s)	150
Hpy8I	GTNNAC	1 cut(s)	139
HpyCH4III	ACNGT	2 cut(s)	71, 143
HpyCH4V	TGCA	1 cut(s)	23
HpyF3I	CTNAG	1 cut(s)	147
Hsp92II	CATG	4 cut(s)	17, 47, 91, 104
LpnPI	CCDG	2 cut(s)	45, 131
MboII	GAAGA	1 cut(s)	64
MluCI	AATT	1 cut(s)	106
MseI	TTAA	3 cut(s)	110, 125, 158
NlaIII	CATG	4 cut(s)	17, 47, 91, 104
RsaI	GTAC	1 cut(s)	145
RsaNI	GTAC	1 cut(s)	144
SaqAI	TTAA	3 cut(s)	110, 125, 158
ScaI	AGTACT	1 cut(s)	145
SetI	ASST	2 cut(s)	120, 174
SgeI	CNNG	7 cut(s)	26, 56, 72, 88, 100, 113, 130
Sse9I	AATT	1 cut(s)	106
TaaI	ACNGT	2 cut(s)	71, 143
TasI	AATT	1 cut(s)	106
TatI	WGTACW	1 cut(s)	143
Tru1I	TTAA	3 cut(s)	110, 125, 158
Tru9I	TTAA	3 cut(s)	110, 125, 158
XapI	RAATTY	1 cut(s)	106
XmiI	GTMKAC	1 cut(s)	138
ZrmI	AGTACT	1 cut(s)	145

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.