Rh1AG437400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
66132238 .. 66133004
767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG437400.1

Sequence Viewer

Length: 534 bp
ATGAAGACTGTGAATTATATACATAAGCATAAACTGTTGCATGAGGGTTTGAGCAAGACATGTAATTACGCTTTGATTGAAGACCTGAAGACTAGAACCATAAAGATCAAAATTATTTTTGATAAGGCATGGAGTGTTGATAACTCGTTTAAGGGGACTGATGGATACCTAAACAATTCTGGATTTTATGGATTGAAGAGATTGAAAGATTGGACCGACTGTAGAGGTGTTCTCAAGGATTTTGTTTTGAAGTCTTTAGGAGAATCAGATGAGACAAATTCATTCTTGGCGTTTTTTTATTATACTGAAGGCGATTTCAGCAAAAGCACGATATCTACGTTTAAAGGGACTGATGGATACCTAACCAATTCTGGTTTTTATGGATTGAAGAGATTGAAAGATTGGACTGACTGTAGAGGTGTTCTTAAGGATTTTGTTTTGAAGTCTTTGGGAGAATCAGATGAGACAAATTCATTCTTGGCGTTTTTTGATTATACTGAAGGCGATTTCAGGTATGATATCTTCATTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

177

Amino Acids

20.43

Weight (kDa)

6.82

Isoelectric Point (pI)

12.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 277, 469
AcuI CTGAAG 3 cut(s) 107, 327, 519
AflII CTTAAG 1 cut(s) 425
AflIII ACRYGT 1 cut(s) 59
AgsI TTSAA 7 cut(s) 80, 196, 205, 250, 388, 397, 442
Alw26I GTCTC 2 cut(s) 266, 458
ApoI RAATTY 2 cut(s) 277, 469
AspS9I GGNCC 1 cut(s) 213
AvaII GGWCC 1 cut(s) 213
BarI GAAGNNNNNNTAC 1 cut(s) 506
BbsI GAAGAC 3 cut(s) 11, 87, 95
BccI CCATC 2 cut(s) 155, 347
BciVI GTATCC 2 cut(s) 158, 350
BcoDI GTCTC 2 cut(s) 266, 458
BfaI CTAG 1 cut(s) 93
BfmI CTRYAG 2 cut(s) 220, 412
BfrI CTTAAG 1 cut(s) 425
BfuI GTATCC 2 cut(s) 158, 350
Bme18I GGWCC 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 213
BpiI GAAGAC 3 cut(s) 11, 87, 95
BplI GAGNNNNNCTC 2 cut(s) 216, 248
BpuEI CTTGAG 1 cut(s) 218
BslFI GGGAC 2 cut(s) 169, 361
BsmAI GTCTC 2 cut(s) 266, 458
BsmFI GGGAC 2 cut(s) 169, 361
Bsp143I GATC 1 cut(s) 105
BspTI CTTAAG 1 cut(s) 425
BssMI GATC 1 cut(s) 105
Bst4CI ACNGT 4 cut(s) 10, 36, 221, 413
Bst6I CTCTTC 2 cut(s) 191, 383
BstAFI CTTAAG 1 cut(s) 425
BstKTI GATC 1 cut(s) 108
BstMAI GTCTC 2 cut(s) 266, 458
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstNSI RCATGY 1 cut(s) 63
BstSFI CTRYAG 2 cut(s) 220, 412
BstV2I GAAGAC 3 cut(s) 11, 87, 95
BsuI GTATCC 2 cut(s) 158, 350
Cfr13I GGNCC 1 cut(s) 213
CviAII CATG 3 cut(s) 41, 60, 129
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
DraI TTTAAA 1 cut(s) 343
Eam1104I CTCTTC 2 cut(s) 191, 383
EarI CTCTTC 2 cut(s) 191, 383
Eco32I GATATC 2 cut(s) 333, 520
Eco47I GGWCC 1 cut(s) 213
Eco57I CTGAAG 3 cut(s) 107, 327, 519
EcoRV GATATC 2 cut(s) 333, 520
FaeI CATG 3 cut(s) 44, 63, 132
FaqI GGGAC 2 cut(s) 169, 361
FatI CATG 3 cut(s) 40, 59, 128
FspBI CTAG 1 cut(s) 93
Hin1II CATG 3 cut(s) 44, 63, 132
HinfI GANTC 2 cut(s) 263, 455
Hpy188I TCNGA 2 cut(s) 268, 460
Hpy188III TCNNGA 1 cut(s) 180
HpyAV CCTTC 2 cut(s) 302, 494
HpyCH4III ACNGT 4 cut(s) 10, 36, 221, 413
HpyCH4IV ACGT 1 cut(s) 338
HpyCH4V TGCA 1 cut(s) 40
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpySE526I ACGT 1 cut(s) 338
Hsp92II CATG 3 cut(s) 44, 63, 132
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 4 cut(s) 98, 165, 357, 496
MaeI CTAG 1 cut(s) 93
MaeII ACGT 1 cut(s) 338
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 6 cut(s) 16, 92, 100, 208, 400, 514
MluCI AATT 7 cut(s) 13, 64, 111, 175, 277, 367, 469
MnlI CCTC 3 cut(s) 37, 218, 410
MseI TTAA 4 cut(s) 150, 342, 426, 532
MspCI CTTAAG 1 cut(s) 425
MwoI GCNNNNNNNGC 1 cut(s) 318
NdeII GATC 1 cut(s) 105
NlaIII CATG 3 cut(s) 44, 63, 132
NspI RCATGY 1 cut(s) 63
PciI ACATGT 1 cut(s) 59
PcsI WCGNNNNNNNCGW 1 cut(s) 335
PfeI GAWTC 2 cut(s) 263, 455
PscI ACATGT 1 cut(s) 59
PspPI GGNCC 1 cut(s) 213
SaqAI TTAA 4 cut(s) 150, 342, 426, 532
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 213
SetI ASST 7 cut(s) 87, 171, 229, 341, 363, 421, 515
SfcI CTRYAG 2 cut(s) 220, 412
SinI GGWCC 1 cut(s) 213
SmlI CTYRAG 2 cut(s) 233, 425
SmoI CTYRAG 2 cut(s) 233, 425
Sse9I AATT 7 cut(s) 13, 64, 111, 175, 277, 367, 469
SspMI CTAG 1 cut(s) 93
TaaI ACNGT 4 cut(s) 10, 36, 221, 413
TaiI ACGT 1 cut(s) 341
TaqII GACCGA 1 cut(s) 230
TasI AATT 7 cut(s) 13, 64, 111, 175, 277, 367, 469
TfiI GAWTC 2 cut(s) 263, 455
Tru1I TTAA 4 cut(s) 150, 342, 426, 532
Tru9I TTAA 4 cut(s) 150, 342, 426, 532
TspDTI ATGAA 4 cut(s) 17, 270, 462, 514
Vha464I CTTAAG 1 cut(s) 425
VpaK11BI GGWCC 1 cut(s) 213
XapI RAATTY 2 cut(s) 277, 469
XceI RCATGY 1 cut(s) 63
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.