Rmu_sc0022226.1_g000003

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022226.1
Physical Location & Seq
Reverse (-)
9771 .. 10211
441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022226.1_g000003.1.cds

Sequence Viewer

Length: 441 bp
atggactacaatccaaatggattgaagatttctgatatttaccgtttcgggtcaaagtccatgtcttatgaccatgagaatttaaccacacctgatattaagttgttgagcatacaatactcggatattgttaagtataaaatacctaaagcaagtatagaggagatgactaaagtagatagaaatattgtagatgaattgttggcactaaaacatatgaaggattatcatggtgacatgcaatccatgaaagatgacaataagaagatacaagttgaagctttccattcacacaacattaaatatttcgaggaacttgccaccctagtaaattcagaaaggattctagtcgagcaaggggagctggtagagcgtattgcagggagtcagaacaacttcttattgaacacatataaggtatgtagtgttgcatggtattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

17.0

Weight (kDa)

5.71

Isoelectric Point (pI)

23.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 79, 331
AgsI TTSAA 3 cut(s) 25, 278, 406
AluBI AGCT 2 cut(s) 281, 364
AluI AGCT 2 cut(s) 281, 364
ApoI RAATTY 2 cut(s) 79, 331
ArsI GACNNNNNNTTYG 2 cut(s) 47, 79
Asp700I GAANNNNTTC 2 cut(s) 342, 395
AsuHPI GGTGA 1 cut(s) 245
BcgI CGANNNNNNTGC 2 cut(s) 299, 333
BfaI CTAG 2 cut(s) 326, 347
BseRI GAGGAG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 44
BstMWI GCNNNNNNNGC 2 cut(s) 361, 370
BstNSI RCATGY 1 cut(s) 241
CviAII CATG 6 cut(s) 61, 74, 230, 238, 247, 432
CviJI RGCY 2 cut(s) 281, 364
CviKI_1 RGCY 2 cut(s) 281, 364
FaeI CATG 6 cut(s) 64, 77, 233, 241, 250, 435
FatI CATG 6 cut(s) 60, 73, 229, 237, 246, 431
FauNDI CATATG 1 cut(s) 216
FspBI CTAG 2 cut(s) 326, 347
Hin1II CATG 6 cut(s) 64, 77, 233, 241, 250, 435
HindIII AAGCTT 1 cut(s) 279
HinfI GANTC 2 cut(s) 343, 385
HphI GGTGA 1 cut(s) 245
Hpy188I TCNGA 4 cut(s) 34, 124, 337, 390
HpyAV CCTTC 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 3 cut(s) 241, 380, 431
HpyF10VI GCNNNNNNNGC 2 cut(s) 361, 370
Hsp92II CATG 6 cut(s) 64, 77, 233, 241, 250, 435
LmnI GCTCC 1 cut(s) 361
LpnPI CCDG 3 cut(s) 105, 350, 366
MaeI CTAG 2 cut(s) 326, 347
MaeIII GTNAC 1 cut(s) 233
MboII GAAGA 2 cut(s) 37, 277
MluCI AATT 3 cut(s) 79, 197, 331
MlyI GAGTC 1 cut(s) 394
MnlI CCTC 2 cut(s) 154, 304
MroXI GAANNNNTTC 2 cut(s) 342, 395
MseI TTAA 5 cut(s) 83, 99, 132, 300, 439
MwoI GCNNNNNNNGC 2 cut(s) 361, 370
NdeI CATATG 1 cut(s) 216
NlaIII CATG 6 cut(s) 64, 77, 233, 241, 250, 435
NmuCI GTSAC 1 cut(s) 233
NspI RCATGY 1 cut(s) 241
PdmI GAANNNNTTC 2 cut(s) 342, 395
PfeI GAWTC 1 cut(s) 343
PleI GAGTC 1 cut(s) 393
PpsI GAGTC 1 cut(s) 393
SaqAI TTAA 5 cut(s) 83, 99, 132, 300, 439
SchI GAGTC 1 cut(s) 394
SetI ASST 5 cut(s) 94, 148, 283, 366, 420
Sse9I AATT 3 cut(s) 79, 197, 331
SspI AATATT 2 cut(s) 187, 305
SspMI CTAG 2 cut(s) 326, 347
TaaI ACNGT 1 cut(s) 44
TaqI TCGA 2 cut(s) 309, 351
TasI AATT 3 cut(s) 79, 197, 331
TfiI GAWTC 1 cut(s) 343
Tru1I TTAA 5 cut(s) 83, 99, 132, 300, 439
Tru9I TTAA 5 cut(s) 83, 99, 132, 300, 439
TseFI GTSAC 1 cut(s) 233
Tsp45I GTSAC 1 cut(s) 233
TspDTI ATGAA 3 cut(s) 210, 233, 263
XapI RAATTY 2 cut(s) 79, 331
XceI RCATGY 1 cut(s) 241
XmnI GAANNNNTTC 2 cut(s) 342, 395
XspI CTAG 2 cut(s) 326, 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.