RchiOBHm_Chr6g0278391

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0009658
Physical Location & Seq
Reverse (-)
41505592 .. 41506173
582 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24972

Sequence Viewer

Length: 582 bp
ATGTTGAAAAAGGTTAAAGATTCAGAAAATTATGCAATTGAAGTGCTGTCAACAGGCAAACAAAATCAGGAGTTTGACGAAGAAAGTGAATATGTTAAGCTCATGACTACCAATATTTTTTTGCACAAATTGATGGACAAACCCAACAATATATTTACGGTGACTATTTCTGTTCTCTTAGAAATATTTAAGTTGTGGAAACCAAACATACATGCAAACGTAAGAGATATTTTTTCTACTAATACGACACTTTATAAAAATCAGCGAAGGATTAGCTCTATTATTGACTACTTATGTTGCACAATTTGTTGTCATCGTTACTGCCTACACTTGTTCGCTACTGACAAAGGAGTCGTTCTGGGTAACATGAAGTACATATATAATGGCAAGGAAATTGATTGTTCGTGTGACAAGTTTGGACAACCGAGCTTGGCAAGAACATACTTGCTTACTAATATGAGCACCATTGATGATAAAGAATTGGCATTCGTTCTAGTAGTGGAGAAACATAGTGTGTTTATGTGGTTGGCTCAAGATATATTTTGGAAGAAATTTAGATGTATAATGATCATTGGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04113 map04113
Pfam Domains
Protein Families
TP6A_N

Protein Analysis

193

Amino Acids

22.56

Weight (kDa)

8.36

Isoelectric Point (pI)

37.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TP6A_N PF04406 52 - 110 5.9e-10 Type IIB DNA topoisomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 255
AasI GACNNNNNNGTC 1 cut(s) 350
AcsI RAATTY 1 cut(s) 551
AfaI GTAC 1 cut(s) 374
AgsI TTSAA 2 cut(s) 7, 41
AluBI AGCT 3 cut(s) 100, 276, 429
AluI AGCT 3 cut(s) 100, 276, 429
Alw21I GWGCWC 1 cut(s) 464
ApoI RAATTY 1 cut(s) 551
AsuHPI GGTGA 1 cut(s) 172
Bbv12I GWGCWC 1 cut(s) 464
BccI CCATC 1 cut(s) 127
BclI TGATCA 1 cut(s) 567
BfaI CTAG 1 cut(s) 494
BpuEI CTTGAG 1 cut(s) 516
BsiHKAI GWGCWC 1 cut(s) 464
BsmI GAATGC 1 cut(s) 485
Bsp1286I GDGCHC 1 cut(s) 464
Bsp143I GATC 1 cut(s) 567
BspHI TCATGA 1 cut(s) 102
BssMI GATC 1 cut(s) 567
Bst4CI ACNGT 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 178
BstKTI GATC 1 cut(s) 570
BstMBI GATC 1 cut(s) 567
BstNSI RCATGY 1 cut(s) 215
CciI TCATGA 1 cut(s) 102
Csp6I GTAC 1 cut(s) 373
CviAII CATG 3 cut(s) 103, 212, 367
CviJI RGCY 4 cut(s) 100, 276, 429, 530
CviKI_1 RGCY 4 cut(s) 100, 276, 429, 530
CviQI GTAC 1 cut(s) 373
DdeI CTNAG 1 cut(s) 178
DpnI GATC 1 cut(s) 569
DpnII GATC 1 cut(s) 567
DrdI GACNNNNNNGTC 1 cut(s) 350
DseDI GACNNNNNNGTC 1 cut(s) 350
FaeI CATG 3 cut(s) 106, 215, 370
FatI CATG 3 cut(s) 102, 211, 366
FbaI TGATCA 1 cut(s) 567
FspBI CTAG 1 cut(s) 494
Hin1II CATG 3 cut(s) 106, 215, 370
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HinfI GANTC 2 cut(s) 20, 351
HphI GGTGA 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 3 cut(s) 68, 103, 533
Hpy8I GTNNAC 1 cut(s) 51
HpyAV CCTTC 1 cut(s) 261
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 4 cut(s) 35, 124, 215, 300
HpyF3I CTNAG 1 cut(s) 178
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 3 cut(s) 106, 215, 370
Ksp22I TGATCA 1 cut(s) 567
Kzo9I GATC 1 cut(s) 567
LpnPI CCDG 3 cut(s) 39, 53, 344
MaeI CTAG 1 cut(s) 494
MaeII ACGT 1 cut(s) 219
MaeIII GTNAC 4 cut(s) 160, 317, 362, 407
MalI GATC 1 cut(s) 569
MboI GATC 1 cut(s) 567
MboII GAAGA 2 cut(s) 92, 559
MfeI CAATTG 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 464
MluCI AATT 7 cut(s) 28, 36, 128, 303, 393, 479, 551
MlyI GAGTC 1 cut(s) 360
MseI TTAA 3 cut(s) 15, 96, 189
MunI CAATTG 1 cut(s) 36
Mva1269I GAATGC 1 cut(s) 485
NdeII GATC 1 cut(s) 567
NlaIII CATG 3 cut(s) 106, 215, 370
NmuCI GTSAC 2 cut(s) 160, 407
NspI RCATGY 1 cut(s) 215
PagI TCATGA 1 cut(s) 102
PctI GAATGC 1 cut(s) 485
PfeI GAWTC 1 cut(s) 20
PleI GAGTC 1 cut(s) 359
PpsI GAGTC 1 cut(s) 359
PsiI TTATAA 1 cut(s) 255
RsaI GTAC 1 cut(s) 374
RsaNI GTAC 1 cut(s) 373
SaqAI TTAA 3 cut(s) 15, 96, 189
Sau3AI GATC 1 cut(s) 567
SchI GAGTC 1 cut(s) 360
SduI GDGCHC 1 cut(s) 464
SetI ASST 5 cut(s) 15, 102, 222, 278, 431
SmlI CTYRAG 1 cut(s) 531
SmoI CTYRAG 1 cut(s) 531
Sse9I AATT 7 cut(s) 28, 36, 128, 303, 393, 479, 551
SspI AATATT 2 cut(s) 115, 186
SspMI CTAG 1 cut(s) 494
TaaI ACNGT 1 cut(s) 160
TaiI ACGT 1 cut(s) 222
TasI AATT 7 cut(s) 28, 36, 128, 303, 393, 479, 551
TatI WGTACW 1 cut(s) 372
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 3 cut(s) 15, 96, 189
Tru9I TTAA 3 cut(s) 15, 96, 189
TseFI GTSAC 2 cut(s) 160, 407
Tsp45I GTSAC 2 cut(s) 160, 407
TspDTI ATGAA 1 cut(s) 383
XapI RAATTY 1 cut(s) 551
XceI RCATGY 1 cut(s) 215
XspI CTAG 1 cut(s) 494
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.