Rh7CG095000

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
7188616 .. 7189668
1053 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG095000.1

Sequence Viewer

Length: 1053 bp
ATGAGTCCAGAGGATGTAAAGTCGATGATTTGTAGATTAAGAGCTTCCGCTCCTGAATTTGGCTTCCCAGTGCCATCAAGGGCCAAAAGCAGTCAGGAGTTCAGCTTCCCTCTCGATTCATGGGTTCTATTACGTAATAGAGAATTCAAGCGGAAAGAGACATGTCGTGAACAATATAATATTACTCACGCTCTGCTCACTCAGATATATAAGCTCTGTACGAAGAAAAAACACATGCAGCTTCGTGAAATCTACTACTCAAATACTAAGCTCTACAAAAATGTGGAAACAGTGGCCGAAGCTGTTAATGACGTATGTTGTATGATCGGCTGCACCAGGAACAGTCTCTATGTTTCTGCAAGTGAAAAAGGTCTCGTTTACGGTGACATTTCTTTCAAGTTGGGTGAAAAGGATTTTGATGGTCGTTCCGCAGGGGCTCGAGGAATAACTATCCCGTCAAACACTAGTTCGATTAGTCATATAGAAAGTAAGGACCCAGCACTTTACTTTGTAATAGTCGTGGAGAAAGATACAGTTTTTGAACGGTTGGCGGAGGATGGATTTTGCGAGGAATACCATTGCGTAATAATAACCGGAAAGGGTATGCCAGGTGTGGATACCAGAATCTTTTTACATAAAATAAGCATTGAGCTACAGCTTCCTGTGTTTGCACTCATGGACTGCAATCCGTATGGACTGAAGATTTATTCTGTTTATCGTCACGGCTCTAAGAAAATGTCTTATGACCGTGATAATTTAACCACACCCTATATTCAGTTGTTGGGCATACGGTACTCGGATATTGAGAAGTTTAAAATACCTGAACAACGTATCGAGGAGTTGACTTATGAAGATAAAGCTACTGCAGAGAGATTGATGACTCGACAATATTTGGAGGATTATCACGATGACTTGCGATTTATAATTAAAACAAAAAAAAAGATACAAATCGAAGCTCTCTATTGTCACGACCTTGATTATTTGGTTAAAGTTGCTTTGCCCATATTTCTTTACGAAAAACTGACTCAACTCTTGATAAGTGAAATATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

350

Amino Acids

40.54

Weight (kDa)

7.52

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TP6A_N PF04406 63 - 118 6.7e-13 Type IIB DNA topoisomerase
TOP6A-Spo11_Toprim PF21180 170 - 334 4.4e-52 Topoisomerase 6 subunit A/Spo11, Toprim domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 923
AccBSI CCGCTC 1 cut(s) 50
AciI CCGC 4 cut(s) 48, 151, 429, 551
AcoI YGGCCR 1 cut(s) 294
AcsI RAATTY 2 cut(s) 56, 143
AcuI CTGAAG 1 cut(s) 719
AfaI GTAC 2 cut(s) 220, 794
AfiI CCNNNNNNNGG 1 cut(s) 59
AflIII ACRYGT 1 cut(s) 161
AgsI TTSAA 3 cut(s) 148, 397, 542
AhlI ACTAGT 1 cut(s) 464
AjnI CCWGG 2 cut(s) 335, 607
Alw26I GTCTC 3 cut(s) 152, 350, 377
Ama87I CYCGRG 1 cut(s) 438
AoxI GGCC 2 cut(s) 81, 294
ApeKI GCWGC 2 cut(s) 238, 330
ApoI RAATTY 2 cut(s) 56, 143
AspS9I GGNCC 2 cut(s) 81, 493
AsuHPI GGTGA 2 cut(s) 395, 416
AvaI CYCGRG 1 cut(s) 438
AvaII GGWCC 1 cut(s) 493
BanII GRGCYC 1 cut(s) 439
BbvI GCAGC 2 cut(s) 250, 317
BccI CCATC 3 cut(s) 82, 413, 551
BceAI ACGGC 1 cut(s) 739
BciT130I CCWGG 2 cut(s) 337, 609
BciVI GTATCC 1 cut(s) 610
BcoDI GTCTC 3 cut(s) 152, 350, 377
BcuI ACTAGT 1 cut(s) 464
BfaI CTAG 1 cut(s) 465
BfmI CTRYAG 2 cut(s) 653, 864
BfuI GTATCC 1 cut(s) 610
BisI GCNGC 2 cut(s) 239, 331
BlsI GCNGC 2 cut(s) 240, 332
Bme1390I CCNGG 2 cut(s) 337, 609
Bme18I GGWCC 1 cut(s) 493
BmeT110I CYCGRG 1 cut(s) 438
BmgT120I GGNCC 2 cut(s) 81, 493
BmiI GGNNCC 1 cut(s) 495
BmrFI CCNGG 2 cut(s) 337, 609
BmrI ACTGGG 1 cut(s) 62
BmuI ACTGGG 1 cut(s) 62
BsaAI YACGTR 1 cut(s) 134
BsaBI GATNNNNATC 1 cut(s) 947
BsaI GGTCTC 1 cut(s) 377
BsaWI WCCGGW 1 cut(s) 593
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 68
Bse3DI GCAATG 1 cut(s) 577
Bse8I GATNNNNATC 1 cut(s) 947
BseBI CCWGG 2 cut(s) 337, 609
BseGI GGATG 2 cut(s) 19, 562
BseJI GATNNNNATC 1 cut(s) 947
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMI GCAATG 1 cut(s) 577
BseMII CTCAG 1 cut(s) 215
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 851
BseXI GCAGC 2 cut(s) 250, 317
BseYI CCCAGC 1 cut(s) 496
BsgI GTGCAG 1 cut(s) 316
BshFI GGCC 2 cut(s) 83, 296
BsiHKCI CYCGRG 1 cut(s) 438
BsiSI CCGG 1 cut(s) 594
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 3 cut(s) 152, 350, 377
BsnI GGCC 2 cut(s) 83, 296
Bso31I GGTCTC 1 cut(s) 377
BsoBI CYCGRG 1 cut(s) 438
Bsp1286I GDGCHC 1 cut(s) 439
Bsp143I GATC 1 cut(s) 324
BspACI CCGC 4 cut(s) 48, 151, 429, 551
BspANI GGCC 2 cut(s) 83, 296
BspCNI CTCAG 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 495
BspMAI CTGCAG 1 cut(s) 868
BspTNI GGTCTC 1 cut(s) 377
BsrBI CCGCTC 1 cut(s) 50
BsrDI GCAATG 1 cut(s) 577
BsrI ACTGG 1 cut(s) 68
BssMI GATC 1 cut(s) 324
Bst2UI CCWGG 2 cut(s) 337, 609
Bst4CI ACNGT 7 cut(s) 292, 344, 383, 535, 546, 749, 792
BstBAI YACGTR 1 cut(s) 134
BstDEI CTNAG 3 cut(s) 201, 267, 729
BstF5I GGATG 2 cut(s) 19, 562
BstKTI GATC 1 cut(s) 327
BstMAI GTCTC 3 cut(s) 152, 350, 377
BstMBI GATC 1 cut(s) 324
BstNI CCWGG 2 cut(s) 337, 609
BstNSI RCATGY 2 cut(s) 165, 238
BstSCI CCNGG 2 cut(s) 335, 607
BstSFI CTRYAG 2 cut(s) 653, 864
BstSNI TACGTA 1 cut(s) 134
BstV1I GCAGC 2 cut(s) 250, 317
BsuI GTATCC 1 cut(s) 610
BsuRI GGCC 2 cut(s) 83, 296
BtsCI GGATG 2 cut(s) 19, 562
BtsIMutI CAGTG 2 cut(s) 75, 297
Cfr13I GGNCC 2 cut(s) 81, 493
Csp6I GTAC 2 cut(s) 219, 793
CviAII CATG 4 cut(s) 120, 162, 235, 676
CviQI GTAC 2 cut(s) 219, 793
DdeI CTNAG 3 cut(s) 201, 267, 729
DpnI GATC 1 cut(s) 326
DpnII GATC 1 cut(s) 324
DraI TTTAAA 1 cut(s) 814
EaeI YGGCCR 1 cut(s) 294
EciI GGCGGA 1 cut(s) 566
Eco105I TACGTA 1 cut(s) 134
Eco24I GRGCYC 1 cut(s) 439
Eco31I GGTCTC 1 cut(s) 377
Eco47I GGWCC 1 cut(s) 493
Eco57I CTGAAG 1 cut(s) 719
Eco88I CYCGRG 1 cut(s) 438
EcoO109I RGGNCCY 1 cut(s) 493
EcoRI GAATTC 1 cut(s) 143
EcoRII CCWGG 2 cut(s) 335, 607
EcoT38I GRGCYC 1 cut(s) 439
FaeI CATG 4 cut(s) 123, 165, 238, 679
FatI CATG 4 cut(s) 119, 161, 234, 675
Fnu4HI GCNGC 2 cut(s) 239, 331
FokI GGATG 2 cut(s) 26, 569
FriOI GRGCYC 1 cut(s) 439
Fsp4HI GCNGC 2 cut(s) 239, 331
FspBI CTAG 1 cut(s) 465
GluI GCNGC 2 cut(s) 239, 331
GsaI CCCAGC 1 cut(s) 500
HaeIII GGCC 2 cut(s) 83, 296
HapII CCGG 1 cut(s) 594
Hin1II CATG 4 cut(s) 123, 165, 238, 679
HincII GTYRAC 1 cut(s) 843
HindII GTYRAC 1 cut(s) 843
HinfI GANTC 5 cut(s) 4, 116, 624, 880, 1024
HpaII CCGG 1 cut(s) 594
HphI GGTGA 2 cut(s) 395, 416
Hpy166II GTNNAC 3 cut(s) 170, 379, 843
Hpy188I TCNGA 2 cut(s) 204, 799
Hpy188III TCNNGA 9 cut(s) 8, 53, 95, 113, 167, 245, 905, 968, 1033
Hpy8I GTNNAC 3 cut(s) 170, 379, 843
HpyCH4III ACNGT 7 cut(s) 292, 344, 383, 535, 546, 749, 792
HpyCH4IV ACGT 3 cut(s) 133, 312, 829
HpyCH4V TGCA 6 cut(s) 238, 333, 359, 671, 684, 866
HpyF3I CTNAG 3 cut(s) 201, 267, 729
HpySE526I ACGT 3 cut(s) 133, 312, 829
Hsp92II CATG 4 cut(s) 123, 165, 238, 679
Kzo9I GATC 1 cut(s) 324
LmnI GCTCC 1 cut(s) 55
Lsp1109I GCAGC 2 cut(s) 250, 317
MaeI CTAG 1 cut(s) 465
MaeII ACGT 3 cut(s) 133, 312, 829
MaeIII GTNAC 3 cut(s) 383, 719, 965
MalI GATC 1 cut(s) 326
MbiI CCGCTC 1 cut(s) 50
MboI GATC 1 cut(s) 324
MboII GAAGA 3 cut(s) 235, 712, 863
MhlI GDGCHC 1 cut(s) 439
MluCI AATT 4 cut(s) 56, 143, 754, 924
MlyI GAGTC 3 cut(s) 13, 874, 1018
MnlI CCTC 7 cut(s) 4, 120, 434, 547, 562, 829, 889
MseI TTAA 6 cut(s) 38, 306, 758, 813, 927, 987
MspI CCGG 1 cut(s) 594
MspR9I CCNGG 2 cut(s) 337, 609
MvaI CCWGG 2 cut(s) 337, 609
NdeII GATC 1 cut(s) 324
NlaIII CATG 4 cut(s) 123, 165, 238, 679
NlaIV GGNNCC 1 cut(s) 495
NmuCI GTSAC 3 cut(s) 383, 719, 965
NspI RCATGY 2 cut(s) 165, 238
PaeR7I CTCGAG 1 cut(s) 438
PciI ACATGT 1 cut(s) 161
PfeI GAWTC 2 cut(s) 116, 624
PkrI GCNGC 2 cut(s) 240, 332
PleI GAGTC 3 cut(s) 12, 874, 1018
PpsI GAGTC 3 cut(s) 12, 874, 1018
Ppu21I YACGTR 1 cut(s) 134
PpuMI RGGWCCY 1 cut(s) 493
PscI ACATGT 1 cut(s) 161
PsiI TTATAA 1 cut(s) 923
Psp5II RGGWCCY 1 cut(s) 493
Psp6I CCWGG 2 cut(s) 335, 607
PspFI CCCAGC 1 cut(s) 496
PspGI CCWGG 2 cut(s) 335, 607
PspN4I GGNNCC 1 cut(s) 495
PspPI GGNCC 2 cut(s) 81, 493
PspPPI RGGWCCY 1 cut(s) 493
PspXI VCTCGAGB 1 cut(s) 438
PstI CTGCAG 1 cut(s) 868
RsaI GTAC 2 cut(s) 220, 794
RsaNI GTAC 2 cut(s) 219, 793
SaqAI TTAA 6 cut(s) 38, 306, 758, 813, 927, 987
SatI GCNGC 2 cut(s) 239, 331
Sau3AI GATC 1 cut(s) 324
Sau96I GGNCC 2 cut(s) 81, 493
SchI GAGTC 3 cut(s) 13, 874, 1018
ScrFI CCNGG 2 cut(s) 337, 609
SduI GDGCHC 1 cut(s) 439
SfcI CTRYAG 2 cut(s) 653, 864
Sfr274I CTCGAG 1 cut(s) 438
SinI GGWCC 1 cut(s) 493
SlaI CTCGAG 1 cut(s) 438
SmlI CTYRAG 1 cut(s) 438
SmoI CTYRAG 1 cut(s) 438
SnaBI TACGTA 1 cut(s) 134
SpeI ACTAGT 1 cut(s) 464
Sse9I AATT 4 cut(s) 56, 143, 754, 924
SsiI CCGC 4 cut(s) 48, 151, 429, 551
SspI AATATT 2 cut(s) 181, 890
SspMI CTAG 1 cut(s) 465
StyD4I CCNGG 2 cut(s) 335, 607
TaaI ACNGT 7 cut(s) 292, 344, 383, 535, 546, 749, 792
TaiI ACGT 3 cut(s) 136, 315, 832
TaqI TCGA 7 cut(s) 23, 114, 439, 470, 834, 883, 951
TasI AATT 4 cut(s) 56, 143, 754, 924
TfiI GAWTC 2 cut(s) 116, 624
Tru1I TTAA 6 cut(s) 38, 306, 758, 813, 927, 987
Tru9I TTAA 6 cut(s) 38, 306, 758, 813, 927, 987
TscAI CASTG 2 cut(s) 75, 297
TseFI GTSAC 3 cut(s) 383, 719, 965
TseI GCWGC 2 cut(s) 238, 330
Tsp45I GTSAC 3 cut(s) 383, 719, 965
TspDTI ATGAA 2 cut(s) 108, 864
TspGWI ACGGA 1 cut(s) 678
TspRI CASTG 2 cut(s) 75, 297
VpaK11BI GGWCC 1 cut(s) 493
XapI RAATTY 2 cut(s) 56, 143
XceI RCATGY 2 cut(s) 165, 238
XhoI CTCGAG 1 cut(s) 438
XspI CTAG 1 cut(s) 465
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.