RCHIOBHM_CPG0501881

One of the essential components for the initiation of protein synthesis. Stabilizes the binding of IF-2 and IF-3 on the 30S subunit to which N-formylmethionyl-tRNA(fMet) subsequently binds. Helps modulate mRNA selection, yielding the 30S pre- initiation complex (PIC). Upon addition of the 50S ribosomal subunit IF-1, IF-2 and IF-3 are released leaving the mature 70S translation initation complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
OG0012929
Physical Location & Seq
Forward (+)
31592 .. 31845
254 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15680

Sequence Viewer

Length: 177 bp
ATGTTTCGAGTTCGTTTAGATAACGAAAATCCGATTCTGGGTTTTGCTTCGGGAAAGGTTCAACGTAATTTTATACGTATACTACCAGTAAATAGAATAAAAATTGTGGTAAGTTCTTATGATTCAACTAAAGGGCATATAATTTGTATATTCAAAAGTAAAGACTCAAATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0009507 GO:0009536 GO:0043021 GO:0043022 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0044877
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
eIF-1a

Protein Analysis

58

Amino Acids

6.65

Weight (kDa)

10.29

Isoelectric Point (pI)

32.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF-1a PF01176 1 - 48 2.2e-09 Translation initiation factor 1A / IF-1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012929)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G11175
fragaria_vesca FvH4_3g20270
malus_domestica MD11G1244000.v1.1
prunus_persica Prupe.4G182300_v2.0.a1 Prupe.4G182400_v2.0.a1
pyrus_communis pycom03g17460 pycom11g21650
rosa_chinensis RchiOBHm_Chr5g0034161 RchiOBHm_CPg0501881
rosa_laevigata RLG00000033528
rosa_multiflora Rmu_ssc0000128.1_g000028
rosa_roxburghii Rroxscaffold_1G00046120
rosa_rugosa Rorug05G0144300
rosa_samantha Rh5AG235700 Rh5BG236500 Rh5CG266500 Rh5DG243500
rosa_wichuraiana Rw5G021360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 79
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 3 cut(s) 62, 126, 154
BsaAI YACGTR 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse1I ACTGG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 38
BseNI ACTGG 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 38
BsrI ACTGG 1 cut(s) 86
BssNAI GTATAC 1 cut(s) 80
Bst1107I GTATAC 1 cut(s) 80
BstBAI YACGTR 1 cut(s) 77
BstSNI TACGTA 1 cut(s) 77
BstZ17I GTATAC 1 cut(s) 80
Eco105I TACGTA 1 cut(s) 77
FaiI YATR 6 cut(s) 74, 80, 120, 138, 140, 149
FblI GTMKAC 1 cut(s) 79
HinfI GANTC 3 cut(s) 34, 122, 164
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 33
Hpy188III TCNNGA 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4IV ACGT 2 cut(s) 64, 76
HpySE526I ACGT 2 cut(s) 64, 76
LpnPI CCDG 2 cut(s) 23, 99
MaeII ACGT 2 cut(s) 64, 76
MluCI AATT 4 cut(s) 67, 102, 141, 172
MlyI GAGTC 1 cut(s) 158
PfeI GAWTC 2 cut(s) 34, 122
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
Ppu21I YACGTR 1 cut(s) 77
SchI GAGTC 1 cut(s) 158
SetI ASST 3 cut(s) 60, 67, 79
SgeI CNNG 4 cut(s) 20, 50, 63, 98
SnaBI TACGTA 1 cut(s) 77
Sse9I AATT 4 cut(s) 67, 102, 141, 172
TaiI ACGT 2 cut(s) 67, 79
TaqI TCGA 1 cut(s) 7
TasI AATT 4 cut(s) 67, 102, 141, 172
TfiI GAWTC 2 cut(s) 34, 122
XmiI GTMKAC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.