Rmu_ssc0000128.1_g000028

Translation initiation factor IF-1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000128.1
Physical Location & Seq
Reverse (-)
135196 .. 135621
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000128.1_g000028.1.cds

Sequence Viewer

Length: 426 bp
atgttaacctcaacatcatcatcctcacttcaccacccaatcctccacactcccctccaccccaaaaccccaaccctcaccccaccttccctcaaattccaaccaaacccaaaacctcagcttcacctcggaacctcaatcctcatctccaaacgttgtcccaacatcgttgccatgagtaaatccccgaaagttgaggagcagaagttcagcgcagagggtctggtcacggagtcgctcccgaacggcatgtttcgaatccgattagacaacgcggacaacatcataggatacatttctgggaaaatccgaaagagtttcattaggattttacctggggatagagtcaaagttgaggtcagtcgctatgatactactagaggtcgaattgtttatagactccgtaacactagggattctccctga
Functional Annotation

Protein Analysis

141

Amino Acids

15.84

Weight (kDa)

10.47

Isoelectric Point (pI)

43.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012929)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 275
AciI CCGC 1 cut(s) 275
AclI AACGTT 1 cut(s) 154
AcsI RAATTY 1 cut(s) 95
AjnI CCWGG 1 cut(s) 334
AloI GAACNNNNNNTCC 2 cut(s) 191, 223
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
ApoI RAATTY 1 cut(s) 95
ArsI GACNNNNNNTTYG 2 cut(s) 342, 374
AspLEI GCGC 1 cut(s) 215
AsuHPI GGTGA 3 cut(s) 23, 70, 116
AsuII TTCGAA 1 cut(s) 256
BbvCI CCTCAGC 1 cut(s) 117
BceAI ACGGC 1 cut(s) 262
BciT130I CCWGG 1 cut(s) 336
BciVI GTATCC 1 cut(s) 284
BfaI CTAG 2 cut(s) 378, 411
BfuI GTATCC 1 cut(s) 284
Bme1390I CCNGG 1 cut(s) 336
BmiI GGNNCC 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 336
Bpu10I CCTNAGC 1 cut(s) 117
Bpu14I TTCGAA 1 cut(s) 256
BsaJI CCNNGG 2 cut(s) 127, 335
BsaXI ACNNNNNCTCC 2 cut(s) 191, 221
BseBI CCWGG 1 cut(s) 336
BseDI CCNNGG 2 cut(s) 127, 335
BseGI GGATG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 131
BseRI GAGGAG 1 cut(s) 212
Bsh1236I CGCG 1 cut(s) 275
BslFI GGGAC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 144
Bsp119I TTCGAA 1 cut(s) 256
BspACI CCGC 1 cut(s) 275
BspCNI CTCAG 1 cut(s) 130
BspFNI CGCG 1 cut(s) 275
BspLI GGNNCC 1 cut(s) 133
BspT104I TTCGAA 1 cut(s) 256
BssECI CCNNGG 2 cut(s) 127, 335
Bst2UI CCWGG 1 cut(s) 336
BstBI TTCGAA 1 cut(s) 256
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 20
BstFNI CGCG 1 cut(s) 275
BstHHI GCGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 336
BstNSI RCATGY 1 cut(s) 253
BstSCI CCNGG 1 cut(s) 334
BstUI CGCG 1 cut(s) 275
BsuI GTATCC 1 cut(s) 284
BtsCI GGATG 1 cut(s) 20
CfoI GCGC 1 cut(s) 215
CviAII CATG 2 cut(s) 175, 250
CviJI RGCY 1 cut(s) 121
CviKI_1 RGCY 1 cut(s) 121
DdeI CTNAG 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 334
FaeI CATG 2 cut(s) 178, 253
FaiI YATR 5 cut(s) 176, 251, 287, 369, 396
FaqI GGGAC 1 cut(s) 144
FatI CATG 2 cut(s) 174, 249
FokI GGATG 1 cut(s) 7
FspBI CTAG 2 cut(s) 378, 411
GlaI GCGC 1 cut(s) 214
HhaI GCGC 1 cut(s) 215
Hin1II CATG 2 cut(s) 178, 253
Hin6I GCGC 1 cut(s) 213
HinP1I GCGC 1 cut(s) 213
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 5 cut(s) 233, 258, 345, 399, 416
HpaI GTTAAC 1 cut(s) 6
HphI GGTGA 3 cut(s) 23, 70, 116
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 3 cut(s) 131, 263, 311
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 96
HpyCH4IV ACGT 1 cut(s) 154
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 2 cut(s) 178, 253
HspAI GCGC 1 cut(s) 213
KspAI GTTAAC 1 cut(s) 6
LmnI GCTCC 2 cut(s) 199, 243
LpnPI CCDG 4 cut(s) 209, 285, 321, 348
MaeI CTAG 2 cut(s) 378, 411
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 2 cut(s) 226, 404
MluCI AATT 2 cut(s) 95, 387
MlyI GAGTC 3 cut(s) 242, 354, 393
MmeI TCCRAC 1 cut(s) 124
MseI TTAA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 336
MvaI CCWGG 1 cut(s) 336
MvnI CGCG 1 cut(s) 275
NlaIII CATG 2 cut(s) 178, 253
NlaIV GGNNCC 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 226
NspI RCATGY 1 cut(s) 253
NspV TTCGAA 1 cut(s) 256
PfeI GAWTC 2 cut(s) 258, 416
PleI GAGTC 3 cut(s) 241, 353, 393
PpsI GAGTC 3 cut(s) 241, 353, 393
Psp1406I AACGTT 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 334
PspGI CCWGG 1 cut(s) 334
PspN4I GGNNCC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 5
SchI GAGTC 3 cut(s) 242, 354, 393
ScrFI CCNGG 1 cut(s) 336
SfuI TTCGAA 1 cut(s) 256
Sse9I AATT 2 cut(s) 95, 387
SsiI CCGC 1 cut(s) 275
SspMI CTAG 2 cut(s) 378, 411
StyD4I CCNGG 1 cut(s) 334
TaiI ACGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 256, 385
TasI AATT 2 cut(s) 95, 387
TfiI GAWTC 2 cut(s) 258, 416
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TseFI GTSAC 1 cut(s) 226
Tsp45I GTSAC 1 cut(s) 226
TspDTI ATGAA 1 cut(s) 310
TspGWI ACGGA 2 cut(s) 245, 392
XapI RAATTY 1 cut(s) 95
XceI RCATGY 1 cut(s) 253
XspI CTAG 2 cut(s) 378, 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.