RCHIOBHM_CHR0C44G0503671

No description available

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGCTGAAAATCGTCAGAATCAACAGAAAATTCAACGAATCTGCAGTGGTGAGGGCTTTGTTGCAACAAGAACTAGATGTAATCGTGTTGATCAGGTTAAATCACGTAGATGGAAAACAGTGTCTTATCCAGAAATTGCTGAAGTATCAAATAGCAACGACCAAAATATCACTGCAGTTGCGAACGAAAATCCGCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.74

Weight (kDa)

10.72

Isoelectric Point (pI)

22.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 193
AcsI RAATTY 1 cut(s) 29
AcuI CTGAAG 1 cut(s) 161
AgsI TTSAA 1 cut(s) 34
ApoI RAATTY 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 61
BccI CCATC 1 cut(s) 104
BclI TGATCA 1 cut(s) 90
BfaI CTAG 1 cut(s) 74
BfmI CTRYAG 2 cut(s) 42, 173
BsaAI YACGTR 1 cut(s) 106
Bsp143I GATC 1 cut(s) 90
BspACI CCGC 1 cut(s) 193
BspMAI CTGCAG 2 cut(s) 46, 177
BssMI GATC 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 120
BstBAI YACGTR 1 cut(s) 106
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstSFI CTRYAG 2 cut(s) 42, 173
BtsI GCAGTG 2 cut(s) 51, 170
BtsIMutI CAGTG 3 cut(s) 51, 125, 170
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 161
FaiI YATR 2 cut(s) 197, 199
FauNDI CATATG 1 cut(s) 197
FbaI TGATCA 1 cut(s) 90
FspBI CTAG 1 cut(s) 74
FspEI CC 7 cut(s) 32, 37, 38, 79, 96, 143, 175
HinfI GANTC 2 cut(s) 18, 38
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 3 cut(s) 44, 64, 175
HpySE526I ACGT 1 cut(s) 105
Ksp22I TGATCA 1 cut(s) 90
Kzo9I GATC 1 cut(s) 90
LpnPI CCDG 2 cut(s) 79, 143
MaeI CTAG 1 cut(s) 74
MaeII ACGT 1 cut(s) 105
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MluCI AATT 2 cut(s) 29, 134
MnlI CCTC 1 cut(s) 45
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 108
NdeI CATATG 1 cut(s) 197
NdeII GATC 1 cut(s) 90
PfeI GAWTC 2 cut(s) 18, 38
Ppu21I YACGTR 1 cut(s) 106
PstI CTGCAG 2 cut(s) 46, 177
RseI CAYNNNNRTG 1 cut(s) 108
SaqAI TTAA 1 cut(s) 98
Sau3AI GATC 1 cut(s) 90
SetI ASST 2 cut(s) 98, 108
SfcI CTRYAG 2 cut(s) 42, 173
SgeI CNNG 6 cut(s) 80, 86, 97, 106, 116, 142
SmiMI CAYNNNNRTG 1 cut(s) 108
Sse9I AATT 2 cut(s) 29, 134
SsiI CCGC 1 cut(s) 193
SspMI CTAG 1 cut(s) 74
TaaI ACNGT 1 cut(s) 120
TaiI ACGT 1 cut(s) 108
TasI AATT 2 cut(s) 29, 134
TfiI GAWTC 2 cut(s) 18, 38
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TscAI CASTG 3 cut(s) 51, 125, 177
TspRI CASTG 3 cut(s) 51, 125, 177
XapI RAATTY 1 cut(s) 29
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.