Rh5CG334300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
37871785 .. 37873323
1539 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG334300.1

Sequence Viewer

Length: 219 bp
ATGGTTTATATAAACCAAGGTATTCATGATATTATAACAAGGCATAGCACTAGCATAAGTATATATATAATTATAATTGTTGTGAACTGGGAAAGTTTGATTATGATTGTTATTACCAGGGATAAATATCTAAAATTTAAACTACATTATATATTTGAATGCAGCGATGGCACCAAAAACTATAATGAGAGGAGCAAAAAGATTGTTAGAAGAGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.63

Weight (kDa)

9.61

Isoelectric Point (pI)

26.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 35, 74
AccB1I GGYRCC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 134
AgsI TTSAA 1 cut(s) 158
AjnI CCWGG 1 cut(s) 116
ApeKI GCWGC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 134
BanI GGYRCC 1 cut(s) 170
BbvI GCAGC 1 cut(s) 174
BccI CCATC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 118
BfaI CTAG 1 cut(s) 51
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 118
BmiI GGNNCC 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 118
BmrI ACTGGG 1 cut(s) 97
BmuI ACTGGG 1 cut(s) 97
BsaBI GATNNNNATC 1 cut(s) 126
BsaJI CCNNGG 2 cut(s) 16, 117
Bse1I ACTGG 1 cut(s) 92
Bse8I GATNNNNATC 1 cut(s) 126
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 2 cut(s) 16, 117
BseJI GATNNNNATC 1 cut(s) 126
BseNI ACTGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 205
BseXI GCAGC 1 cut(s) 174
BshNI GGYRCC 1 cut(s) 170
BsmI GAATGC 1 cut(s) 164
BspHI TCATGA 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 172
BspT107I GGYRCC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 92
BssECI CCNNGG 2 cut(s) 16, 117
BssT1I CCWWGG 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 118
Bst6I CTCTTC 1 cut(s) 205
BstMWI GCNNNNNNNGC 1 cut(s) 168
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
BstV1I GCAGC 1 cut(s) 174
BtgZI GCGATG 1 cut(s) 180
CciI TCATGA 1 cut(s) 25
CviAII CATG 1 cut(s) 26
DraI TTTAAA 1 cut(s) 139
Eam1104I CTCTTC 1 cut(s) 205
EarI CTCTTC 1 cut(s) 205
Eco130I CCWWGG 1 cut(s) 16
EcoRII CCWGG 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 1 cut(s) 29
FatI CATG 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 163
Fsp4HI GCNGC 1 cut(s) 163
FspBI CTAG 1 cut(s) 51
GluI GCNGC 1 cut(s) 163
Hin1II CATG 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 168
Hsp92II CATG 1 cut(s) 29
LmnI GCTCC 1 cut(s) 192
LpnPI CCDG 3 cut(s) 73, 103, 130
Lsp1109I GCAGC 1 cut(s) 174
MaeI CTAG 1 cut(s) 51
MluCI AATT 3 cut(s) 69, 75, 134
MnlI CCTC 1 cut(s) 183
MseI TTAA 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 118
Mva1269I GAATGC 1 cut(s) 164
MvaI CCWGG 1 cut(s) 118
MwoI GCNNNNNNNGC 1 cut(s) 168
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 1 cut(s) 172
PagI TCATGA 1 cut(s) 25
PctI GAATGC 1 cut(s) 164
PkrI GCNGC 1 cut(s) 164
PsiI TTATAA 2 cut(s) 35, 74
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 118
SetI ASST 1 cut(s) 22
SgeI CNNG 7 cut(s) 29, 38, 51, 63, 100, 129, 130
Sse9I AATT 3 cut(s) 69, 75, 134
SspMI CTAG 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 116
StyI CCWWGG 1 cut(s) 16
TasI AATT 3 cut(s) 69, 75, 134
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseI GCWGC 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 14
XapI RAATTY 1 cut(s) 134
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.