Rh7DG420200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
59296086 .. 59310085
14000 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG420200.1

Sequence Viewer

Length: 321 bp
ATGATGAGAGGAGCAAAAAGATTGTTAGAACAGTGCGATGCTGAAAATCGTCAGAATCAACAGAAAATTCTACGAATCTGCAGTGGTGAGGGCTTTGTTGCAACAAGAACTAGATGTAATCGTGTTGATCAGGTTAAATCACGTAGATGGAAAACAGTGTCTTATCCAGAAATTGCTGAAGTATCAAATAGCAACGACCAAAATATCACTGCGATTGCGAACGAAAATCCGCATATGATTACAGAAGCTGAAATTTCGGAGGACTTATCATTTGTTGCAAATGACGAATCAGACTTTGTACATAAACACCTACTGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.16

Weight (kDa)

5.9

Isoelectric Point (pI)

47.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 230
AcsI RAATTY 2 cut(s) 66, 252
AcuI CTGAAG 1 cut(s) 198
AfaI GTAC 1 cut(s) 300
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
AlwNI CAGNNNCTG 1 cut(s) 248
ApoI RAATTY 2 cut(s) 66, 252
ArsI GACNNNNNNTTYG 2 cut(s) 254, 286
AsuHPI GGTGA 1 cut(s) 98
BccI CCATC 1 cut(s) 141
BclI TGATCA 1 cut(s) 127
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 79
BmsI GCATC 1 cut(s) 28
BsaAI YACGTR 1 cut(s) 143
BseRI GAGGAG 1 cut(s) 24
Bsp1407I TGTACA 1 cut(s) 298
Bsp143I GATC 1 cut(s) 127
BspACI CCGC 1 cut(s) 230
BspMAI CTGCAG 1 cut(s) 83
BsrGI TGTACA 1 cut(s) 298
BssMI GATC 1 cut(s) 127
Bst4CI ACNGT 3 cut(s) 33, 157, 315
BstAUI TGTACA 1 cut(s) 298
BstBAI YACGTR 1 cut(s) 143
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstSFI CTRYAG 1 cut(s) 79
BtgZI GCGATG 1 cut(s) 51
BtsI GCAGTG 2 cut(s) 88, 207
BtsIMutI CAGTG 4 cut(s) 38, 88, 162, 207
CaiI CAGNNNCTG 1 cut(s) 248
Csp6I GTAC 1 cut(s) 299
CviJI RGCY 2 cut(s) 93, 248
CviKI_1 RGCY 2 cut(s) 93, 248
CviQI GTAC 1 cut(s) 299
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 198
FaiI YATR 3 cut(s) 234, 236, 303
FauNDI CATATG 1 cut(s) 234
FbaI TGATCA 1 cut(s) 127
FspBI CTAG 1 cut(s) 111
HinfI GANTC 3 cut(s) 55, 75, 287
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 3 cut(s) 54, 259, 292
Hpy188III TCNNGA 1 cut(s) 167
HpyCH4III ACNGT 3 cut(s) 33, 157, 315
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 3 cut(s) 81, 101, 278
HpySE526I ACGT 1 cut(s) 142
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 2 cut(s) 116, 180
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 142
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MluCI AATT 3 cut(s) 66, 171, 252
MnlI CCTC 2 cut(s) 82, 253
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 145
NdeI CATATG 1 cut(s) 234
NdeII GATC 1 cut(s) 127
PfeI GAWTC 3 cut(s) 55, 75, 287
Ppu21I YACGTR 1 cut(s) 143
PstI CTGCAG 1 cut(s) 83
PstNI CAGNNNCTG 1 cut(s) 248
RsaI GTAC 1 cut(s) 300
RsaNI GTAC 1 cut(s) 299
RseI CAYNNNNRTG 1 cut(s) 145
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 127
SetI ASST 4 cut(s) 135, 145, 250, 312
SfaNI GCATC 1 cut(s) 28
SfcI CTRYAG 1 cut(s) 79
SgeI CNNG 6 cut(s) 117, 123, 134, 143, 153, 179
SmiMI CAYNNNNRTG 1 cut(s) 145
Sse9I AATT 3 cut(s) 66, 171, 252
SsiI CCGC 1 cut(s) 230
SspMI CTAG 1 cut(s) 111
TaaI ACNGT 3 cut(s) 33, 157, 315
TaiI ACGT 1 cut(s) 145
TasI AATT 3 cut(s) 66, 171, 252
TatI WGTACW 1 cut(s) 298
TfiI GAWTC 3 cut(s) 55, 75, 287
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 4 cut(s) 38, 88, 162, 214
TspRI CASTG 4 cut(s) 38, 88, 162, 214
XapI RAATTY 2 cut(s) 66, 252
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.