Rorug01G0089800

Belongs to the peptidase M24B family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
14629742 .. 14629903
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0089800.1

Sequence Viewer

Length: 162 bp
ATGAAGTTAAAGAAGGACTCGAATCTCAGCTTAATGAGCTTCTGGAACGGGAGCAGTCCTTTTGGAGACAACGTGCCAAAGTCTTTTGGCTCTCAGACGGTCATCTTAATATTCAGTTCTTTCATCAAATTGCCAGGAATAGAAGGAAGAAGAATAGGGTGA

Protein Analysis

53

Amino Acids

5.83

Weight (kDa)

10.17

Isoelectric Point (pI)

66.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 133
AluBI AGCT 2 cut(s) 30, 39
AluI AGCT 2 cut(s) 30, 39
Alw26I GTCTC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 135
BmrFI CCNGG 1 cut(s) 135
BsaXI ACNNNNNCTCC 2 cut(s) 57, 87
BseBI CCWGG 1 cut(s) 135
BseMII CTCAG 2 cut(s) 40, 107
BsmAI GTCTC 1 cut(s) 60
BspCNI CTCAG 2 cut(s) 39, 106
Bst2UI CCWGG 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 100
BstDEI CTNAG 2 cut(s) 26, 93
BstMAI GTCTC 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstNI CCWGG 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 133
CviJI RGCY 3 cut(s) 30, 39, 90
CviKI_1 RGCY 3 cut(s) 30, 39, 90
DdeI CTNAG 2 cut(s) 26, 93
EcoRII CCWGG 1 cut(s) 133
HinfI GANTC 2 cut(s) 17, 22
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 43
HpyAV CCTTC 2 cut(s) 7, 137
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 72
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpyF3I CTNAG 2 cut(s) 26, 93
HpySE526I ACGT 1 cut(s) 72
LmnI GCTCC 1 cut(s) 51
LpnPI CCDG 3 cut(s) 28, 120, 147
MaeII ACGT 1 cut(s) 72
MboII GAAGA 2 cut(s) 159, 162
MluCI AATT 1 cut(s) 128
MlyI GAGTC 1 cut(s) 11
MseI TTAA 3 cut(s) 8, 32, 107
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 22
PleI GAGTC 1 cut(s) 11
PpsI GAGTC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
SaqAI TTAA 3 cut(s) 8, 32, 107
SchI GAGTC 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 135
SetI ASST 3 cut(s) 32, 41, 75
SgeI CNNG 6 cut(s) 31, 55, 61, 85, 146, 147
Sse9I AATT 1 cut(s) 128
SspI AATATT 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 133
TaaI ACNGT 1 cut(s) 100
TaiI ACGT 1 cut(s) 75
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 128
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 3 cut(s) 8, 32, 107
Tru9I TTAA 3 cut(s) 8, 32, 107
TspDTI ATGAA 2 cut(s) 17, 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.