Rh1AG107800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
18640403 .. 18665205
24803 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG107800.1

Sequence Viewer

Length: 267 bp
ATGGCACCAAAAACTATAATGAGAGGAGCAAAAAGATTGTTAGAAGAGTGTGATGATGGAAATCGTGACAATGAACAAAAAATTCAACAAATTTTGTATGGTGAAGATTTTGTTACAAGAAGAACTACATGTAATCGTGTAAATCAGATTATATCATGTAGATGGAAAAGAGTATCTCATCCAGAAACTGCTGAAGCATCAGAGAGTAACAGCCAAGATATCATTGCAGCTCCAAATGAAAATGCACGTATGATTACAGAAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.05

Weight (kDa)

5.81

Isoelectric Point (pI)

62.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AcsI RAATTY 2 cut(s) 81, 90
AcuI CTGAAG 1 cut(s) 213
AflIII ACRYGT 1 cut(s) 128
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 1 cut(s) 230
AluI AGCT 1 cut(s) 230
AlwNI CAGNNNCTG 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 227
ApoI RAATTY 2 cut(s) 81, 90
AsuHPI GGTGA 1 cut(s) 113
BanI GGYRCC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 239
BccI CCATC 2 cut(s) 50, 156
BisI GCNGC 1 cut(s) 228
BlsI GCNGC 1 cut(s) 229
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 206
BsaAI YACGTR 1 cut(s) 248
BsaBI GATNNNNATC 1 cut(s) 60
Bse3DI GCAATG 1 cut(s) 222
Bse8I GATNNNNATC 1 cut(s) 60
BseGI GGATG 1 cut(s) 178
BseJI GATNNNNATC 1 cut(s) 60
BseMI GCAATG 1 cut(s) 222
BseRI GAGGAG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 239
BshNI GGYRCC 1 cut(s) 4
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
BsrDI GCAATG 1 cut(s) 222
Bst6I CTCTTC 1 cut(s) 39
BstBAI YACGTR 1 cut(s) 248
BstF5I GGATG 1 cut(s) 178
BstNSI RCATGY 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 239
BtsCI GGATG 1 cut(s) 178
CaiI CAGNNNCTG 1 cut(s) 188
CviAII CATG 2 cut(s) 129, 156
CviJI RGCY 3 cut(s) 213, 230, 264
CviKI_1 RGCY 3 cut(s) 213, 230, 264
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco32I GATATC 1 cut(s) 220
Eco57I CTGAAG 1 cut(s) 213
EcoRV GATATC 1 cut(s) 220
FaeI CATG 2 cut(s) 132, 159
FaiI YATR 6 cut(s) 17, 99, 130, 152, 157, 251
FatI CATG 2 cut(s) 128, 155
Fnu4HI GCNGC 1 cut(s) 228
FokI GGATG 1 cut(s) 165
Fsp4HI GCNGC 1 cut(s) 228
FspEI CC 9 cut(s) 9, 21, 42, 84, 148, 195, 227, 246, 246
GluI GCNGC 1 cut(s) 228
Hin1II CATG 2 cut(s) 132, 159
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 147, 202
Hpy188III TCNNGA 2 cut(s) 65, 182
HpyAV CCTTC 1 cut(s) 254
HpyCH4IV ACGT 1 cut(s) 247
HpyCH4V TGCA 2 cut(s) 227, 245
HpySE526I ACGT 1 cut(s) 247
Hsp92II CATG 2 cut(s) 132, 159
LmnI GCTCC 2 cut(s) 26, 235
LpnPI CCDG 1 cut(s) 195
Lsp1109I GCAGC 1 cut(s) 239
LweI GCATC 1 cut(s) 206
MaeII ACGT 1 cut(s) 247
MaeIII GTNAC 3 cut(s) 65, 112, 206
MboII GAAGA 3 cut(s) 56, 116, 132
MluCI AATT 2 cut(s) 81, 90
MnlI CCTC 1 cut(s) 17
MslI CAYNNNNRTG 1 cut(s) 160
NlaIII CATG 2 cut(s) 132, 159
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 65
NspI RCATGY 1 cut(s) 132
PciI ACATGT 1 cut(s) 128
PkrI GCNGC 1 cut(s) 229
Ppu21I YACGTR 1 cut(s) 248
PscI ACATGT 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 6
PstNI CAGNNNCTG 1 cut(s) 188
RseI CAYNNNNRTG 1 cut(s) 160
SatI GCNGC 1 cut(s) 228
SetI ASST 2 cut(s) 232, 250
SfaNI GCATC 1 cut(s) 206
SgeI CNNG 8 cut(s) 77, 129, 141, 149, 168, 194, 227, 258
SmiMI CAYNNNNRTG 1 cut(s) 160
Sse9I AATT 2 cut(s) 81, 90
TaiI ACGT 1 cut(s) 250
TasI AATT 2 cut(s) 81, 90
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 1 cut(s) 227
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 2 cut(s) 87, 252
XapI RAATTY 2 cut(s) 81, 90
XceI RCATGY 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.