RchiOBHm_Chr1g0329581

ribosomal protein L2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0003897
Physical Location & Seq
Reverse (-)
19298359 .. 19298700
342 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55888

Sequence Viewer

Length: 159 bp
ATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGGGCCCCAATTGGTAGAAAAAAACCCGCAACCCCTTGGGGTTATCCTGCACTTGGAAGAAGAAGTAGAAAAAGAAATAAATATAGTGATAATTTGATTCTTCGTCGCCGTAGTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L2_C

Protein Analysis

52

Amino Acids

5.91

Weight (kDa)

11.73

Isoelectric Point (pI)

92.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L2_C PF03947 1 - 27 3.7e-08 Ribosomal Proteins L2, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 12
AciI CCGC 1 cut(s) 66
AfiI CCNNNNNNNGG 2 cut(s) 26, 92
AoxI GGCC 1 cut(s) 42
ApaI GGGCCC 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 42, 43
AsuHPI GGTGA 1 cut(s) 44
BaeGI GKGCMC 1 cut(s) 46
BanII GRGCYC 1 cut(s) 46
BccI CCATC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 9
BmgT120I GGNCC 2 cut(s) 42, 43
BmiI GGNNCC 2 cut(s) 44, 45
BsaJI CCNNGG 2 cut(s) 22, 74
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 92
BseDI CCNNGG 2 cut(s) 22, 74
BseGI GGATG 1 cut(s) 16
BseLI CCNNNNNNNGG 2 cut(s) 26, 92
BseSI GKGCMC 1 cut(s) 46
BsgI GTGCAG 1 cut(s) 72
BshFI GGCC 1 cut(s) 44
BslI CCNNNNNNNGG 2 cut(s) 26, 92
BsnI GGCC 1 cut(s) 44
Bsp120I GGGCCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 46
Bsp19I CCATGG 1 cut(s) 22
BspACI CCGC 1 cut(s) 66
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 2 cut(s) 44, 45
BssECI CCNNGG 2 cut(s) 22, 74
BssT1I CCWWGG 2 cut(s) 22, 74
BstDSI CCRYGG 1 cut(s) 22
BstF5I GGATG 1 cut(s) 16
BstSFI CTRYAG 1 cut(s) 9
BstSLI GKGCMC 1 cut(s) 46
BstXI CCANNNNNNTGG 2 cut(s) 23, 29
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 22
BtsCI GGATG 1 cut(s) 16
Cfr13I GGNCC 2 cut(s) 42, 43
CviAII CATG 1 cut(s) 23
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
Eco130I CCWWGG 2 cut(s) 22, 74
Eco24I GRGCYC 1 cut(s) 46
EcoO109I RGGNCCY 2 cut(s) 42, 43
EcoT14I CCWWGG 2 cut(s) 22, 74
EcoT38I GRGCYC 1 cut(s) 46
ErhI CCWWGG 2 cut(s) 22, 74
FaeI CATG 1 cut(s) 26
FaiI YATR 2 cut(s) 24, 123
FatI CATG 1 cut(s) 22
FauI CCCGC 1 cut(s) 73
FblI GTMKAC 1 cut(s) 12
FokI GGATG 1 cut(s) 3
FriOI GRGCYC 1 cut(s) 46
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 1 cut(s) 26
HinfI GANTC 1 cut(s) 136
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 13
Hpy99I CGWCG 1 cut(s) 147
HpyAV CCTTC 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 89
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 2 cut(s) 21, 99
MboII GAAGA 3 cut(s) 108, 111, 131
MfeI CAATTG 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 46
MluCI AATT 2 cut(s) 48, 130
MnlI CCTC 1 cut(s) 33
MslI CAYNNNNRTG 2 cut(s) 21, 27
MunI CAATTG 1 cut(s) 48
NcoI CCATGG 1 cut(s) 22
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 2 cut(s) 44, 45
PfeI GAWTC 1 cut(s) 136
PspN4I GGNNCC 2 cut(s) 44, 45
PspOMI GGGCCC 1 cut(s) 42
PspPI GGNCC 2 cut(s) 42, 43
RseI CAYNNNNRTG 2 cut(s) 21, 27
Sau96I GGNCC 2 cut(s) 42, 43
SduI GDGCHC 1 cut(s) 46
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 6 cut(s) 20, 35, 77, 87, 98, 104
SmiMI CAYNNNNRTG 2 cut(s) 21, 27
Sse9I AATT 2 cut(s) 48, 130
SsiI CCGC 1 cut(s) 66
StyI CCWWGG 2 cut(s) 22, 74
TasI AATT 2 cut(s) 48, 130
TfiI GAWTC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 17
XmiI GTMKAC 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.