RchiOBHm_Chr3g0480391

structural constituent of ribosome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
26223631 .. 26223945
315 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44541

Sequence Viewer

Length: 315 bp
ATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAGGGGAGGGCCCCAATTGGTAGAAAAAAAACCCGCAACCCCTTGGGGTTATCCTGCACTTGGAAGTACAAAAATAAAAACAAGGTAGAAATAGATCACCTGGCTTCTTTTGAATCGAAAATGGTTTGTCAATTACCCAGATTCGTTGAAAGTGAAAGCGATGATCATCATTTGCTTCAAATTTCTTGCAAGTCAGAGGCTTGCCTAACAAATAGAATTAAGTGGATTTTTGAACCGAGCTGCCTCAAATTCTTGTCAAATTCACTACGCTACCACCCCTAG

Protein Analysis

104

Amino Acids

11.93

Weight (kDa)

9.08

Isoelectric Point (pI)

56.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 12
AciI CCGC 1 cut(s) 67
AcsI RAATTY 3 cut(s) 213, 281, 292
AfaI GTAC 1 cut(s) 101
AfiI CCNNNNNNNGG 2 cut(s) 26, 93
AgsI TTSAA 4 cut(s) 146, 182, 212, 266
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 1 cut(s) 273
AluI AGCT 1 cut(s) 273
AoxI GGCC 1 cut(s) 42
ApaI GGGCCC 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 273
ApoI RAATTY 3 cut(s) 213, 281, 292
AspS9I GGNCC 2 cut(s) 42, 43
AsuHPI GGTGA 2 cut(s) 44, 122
BaeGI GKGCMC 1 cut(s) 46
BanII GRGCYC 1 cut(s) 46
BbvI GCAGC 1 cut(s) 260
BccI CCATC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 134
BclI TGATCA 1 cut(s) 196
BfaI CTAG 1 cut(s) 313
BfmI CTRYAG 1 cut(s) 9
BisI GCNGC 1 cut(s) 274
BlsI GCNGC 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 134
BmgT120I GGNCC 2 cut(s) 42, 43
BmiI GGNNCC 2 cut(s) 44, 45
BmrFI CCNGG 1 cut(s) 134
BsaBI GATNNNNATC 1 cut(s) 198
BsaJI CCNNGG 2 cut(s) 22, 75
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 93
Bse8I GATNNNNATC 1 cut(s) 198
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 2 cut(s) 22, 75
BseGI GGATG 1 cut(s) 16
BseJI GATNNNNATC 1 cut(s) 198
BseLI CCNNNNNNNGG 2 cut(s) 26, 93
BseSI GKGCMC 1 cut(s) 46
BseXI GCAGC 1 cut(s) 260
BsgI GTGCAG 1 cut(s) 73
BshFI GGCC 1 cut(s) 44
BslI CCNNNNNNNGG 2 cut(s) 26, 93
BsnI GGCC 1 cut(s) 44
Bsp120I GGGCCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 46
Bsp143I GATC 2 cut(s) 127, 196
Bsp19I CCATGG 1 cut(s) 22
BspACI CCGC 1 cut(s) 67
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 2 cut(s) 44, 45
BssECI CCNNGG 2 cut(s) 22, 75
BssMI GATC 2 cut(s) 127, 196
BssT1I CCWWGG 2 cut(s) 22, 75
Bst2UI CCWGG 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 235
BstDSI CCRYGG 1 cut(s) 22
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 2 cut(s) 130, 199
BstMBI GATC 2 cut(s) 127, 196
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstSFI CTRYAG 1 cut(s) 9
BstSLI GKGCMC 1 cut(s) 46
BstV1I GCAGC 1 cut(s) 260
BstXI CCANNNNNNTGG 2 cut(s) 23, 29
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 22
BtgZI GCGATG 1 cut(s) 207
BtsCI GGATG 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 235
Cfr13I GGNCC 2 cut(s) 42, 43
Csp6I GTAC 1 cut(s) 100
CviAII CATG 1 cut(s) 23
CviJI RGCY 4 cut(s) 44, 137, 233, 273
CviKI_1 RGCY 4 cut(s) 44, 137, 233, 273
CviQI GTAC 1 cut(s) 100
DpnI GATC 2 cut(s) 129, 198
DpnII GATC 2 cut(s) 127, 196
Eco130I CCWWGG 2 cut(s) 22, 75
Eco24I GRGCYC 1 cut(s) 46
EcoO109I RGGNCCY 2 cut(s) 42, 43
EcoRII CCWGG 1 cut(s) 132
EcoT14I CCWWGG 2 cut(s) 22, 75
EcoT38I GRGCYC 1 cut(s) 46
ErhI CCWWGG 2 cut(s) 22, 75
FaeI CATG 1 cut(s) 26
FaiI YATR 1 cut(s) 24
FatI CATG 1 cut(s) 22
FauI CCCGC 1 cut(s) 74
FbaI TGATCA 1 cut(s) 196
FblI GTMKAC 1 cut(s) 12
Fnu4HI GCNGC 1 cut(s) 274
FokI GGATG 1 cut(s) 3
FriOI GRGCYC 1 cut(s) 46
Fsp4HI GCNGC 1 cut(s) 274
FspBI CTAG 1 cut(s) 313
GluI GCNGC 1 cut(s) 274
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 1 cut(s) 26
HinfI GANTC 2 cut(s) 146, 174
HphI GGTGA 2 cut(s) 44, 122
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 229
Hpy8I GTNNAC 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 90, 222
Hsp92II CATG 1 cut(s) 26
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 127, 196
LpnPI CCDG 5 cut(s) 21, 100, 119, 146, 184
Lsp1109I GCAGC 1 cut(s) 260
MaeI CTAG 1 cut(s) 313
MalI GATC 2 cut(s) 129, 198
MboI GATC 2 cut(s) 127, 196
MfeI CAATTG 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 46
MluCI AATT 6 cut(s) 48, 164, 213, 249, 281, 292
MnlI CCTC 4 cut(s) 28, 33, 223, 287
MseI TTAA 1 cut(s) 252
MslI CAYNNNNRTG 2 cut(s) 21, 27
MspR9I CCNGG 1 cut(s) 134
MunI CAATTG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 134
NcoI CCATGG 1 cut(s) 22
NdeII GATC 2 cut(s) 127, 196
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 2 cut(s) 44, 45
PfeI GAWTC 2 cut(s) 146, 174
PkrI GCNGC 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspN4I GGNNCC 2 cut(s) 44, 45
PspOMI GGGCCC 1 cut(s) 42
PspPI GGNCC 2 cut(s) 42, 43
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
RseI CAYNNNNRTG 2 cut(s) 21, 27
SaqAI TTAA 1 cut(s) 252
SatI GCNGC 1 cut(s) 274
Sau3AI GATC 2 cut(s) 127, 196
Sau96I GGNCC 2 cut(s) 42, 43
ScrFI CCNGG 1 cut(s) 134
SduI GDGCHC 1 cut(s) 46
SetI ASST 3 cut(s) 120, 135, 275
SfcI CTRYAG 1 cut(s) 9
SmiMI CAYNNNNRTG 2 cut(s) 21, 27
Sse9I AATT 6 cut(s) 48, 164, 213, 249, 281, 292
SsiI CCGC 1 cut(s) 67
SspMI CTAG 1 cut(s) 313
StyD4I CCNGG 1 cut(s) 132
StyI CCWWGG 2 cut(s) 22, 75
TaqI TCGA 1 cut(s) 149
TasI AATT 6 cut(s) 48, 164, 213, 249, 281, 292
TatI WGTACW 1 cut(s) 99
TfiI GAWTC 2 cut(s) 146, 174
Tru1I TTAA 1 cut(s) 252
Tru9I TTAA 1 cut(s) 252
TseI GCWGC 1 cut(s) 273
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 3 cut(s) 213, 281, 292
XmiI GTMKAC 1 cut(s) 12
XspI CTAG 1 cut(s) 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.