Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0008171

Physical Location & Seq

Genomic Coordinates Forward (+)

20191600 .. 20194781

Gene Structure 3182 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ55968

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGCTCGTCTATTGGATTCTCAAGTCTGCTCATACTCTCCCTGAAAACACTACACACCGGCTCAAAATTGGTGCTTCTGTAATCAATCAAAGCAGAGAGAAGTTGAAGATTGTGTGTTCTTATATGTGTGGTGTGGAAACCTCAATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006950 GO:0006979 GO:0008150 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0036094 GO:0044424 GO:0044444 GO:0044464 GO:0047631 GO:0048037 GO:0050662 GO:0050896 GO:0051287 GO:0097159 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX

Protein Analysis

49

Amino Acids

5.56

Weight (kDa)

9.18

Isoelectric Point (pI)

19.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008171)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0330481 RchiOBHm_Chr1g0343121 RchiOBHm_Chr5g0006981 RchiOBHm_Chr7g0228441
rosa_laevigata	RLG00000009218 RLG00000013428 RLG00000023422 RLG00000028878
rosa_multiflora	Rmu_co8340297.1_g000001 Rmu_sc0027157.1_g000001
rosa_roxburghii	Rroxscaffold_1G00071520 Rroxscaffold_7G00192850
rosa_rugosa	Rorug05G0375200
rosa_samantha	Rh2CG409900 Rh2DG353000 Rh3BG332600 Rh3DG311700 Rh4DG241500 Rh5AG153900 Rh5AG364100 Rh6AG240500 Rh6BG135500 Rh7CG472600 Rh7DG441600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	106
BpuEI	CTTGAG	1 cut(s)	5
Bse118I	RCCGGY	1 cut(s)	57
BsiSI	CCGG	1 cut(s)	58
BsrFI	RCCGGY	1 cut(s)	57
BssAI	RCCGGY	1 cut(s)	57
Cfr10I	RCCGGY	1 cut(s)	57
CviJI	RGCY	1 cut(s)	61
CviKI_1	RGCY	1 cut(s)	61
FaiI	YATR	3 cut(s)	33, 123, 125
FspEI	CC	7 cut(s)	43, 53, 54, 54, 71, 114, 119
HapII	CCGG	1 cut(s)	58
HinfI	GANTC	1 cut(s)	16
HpaII	CCGG	1 cut(s)	58
LpnPI	CCDG	2 cut(s)	54, 71
MboII	GAAGA	1 cut(s)	118
MluCI	AATT	2 cut(s)	66, 144
MspI	CCGG	1 cut(s)	58
PfeI	GAWTC	1 cut(s)	16
SetI	ASST	1 cut(s)	143
SgeI	CNNG	4 cut(s)	17, 34, 53, 70
SmlI	CTYRAG	1 cut(s)	20
SmoI	CTYRAG	1 cut(s)	20
Sse9I	AATT	2 cut(s)	66, 144
TasI	AATT	2 cut(s)	66, 144
TfiI	GAWTC	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.