Rmu_sc0027157.1_g000001

PHD finger family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027157.1
OG0008171
Physical Location & Seq
Reverse (-)
2 .. 444
443 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027157.1_g000001.1.cds

Sequence Viewer

Length: 356 bp
atgttgaatggtggagataggacctccaaagttcgtattaagggaaagtctcatggtctgggtagtgcagaggatactgggaagcatgctggcaagtctaagcctgtgaaagggaagaagctagtgataaactttggtgccaaaaagttaaatataactaaatctccaagttgtgctgcttcaacctatcaaagagaacatgcttcggtgacctccaatggtggtgaagatgtgagccagaggacacaacaagtgaaaatacaaggacagaatataattttctggaaaacgaggattgcagtgtatggatcaatccctactgggcagatatcagaaacaatgaaccaaactccaga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PHD

Protein Analysis

118

Amino Acids

12.65

Weight (kDa)

10.22

Isoelectric Point (pI)

14.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 137
AclWI GGATC 1 cut(s) 316
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 7, 183
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
Alw26I GTCTC 1 cut(s) 54
AlwI GGATC 1 cut(s) 316
ApeKI GCWGC 1 cut(s) 176
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 220, 236
AvaII GGWCC 1 cut(s) 21
BanI GGYRCC 1 cut(s) 137
BbvI GCAGC 1 cut(s) 163
BciVI GTATCC 1 cut(s) 67
BcoDI GTCTC 1 cut(s) 54
BfaI CTAG 1 cut(s) 122
BfuI GTATCC 1 cut(s) 67
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
Bme18I GGWCC 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 139
BmrI ACTGGG 2 cut(s) 87, 330
BmuI ACTGGG 2 cut(s) 87, 330
BpmI CTGGAG 1 cut(s) 336
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 2 cut(s) 82, 325
BseLI CCNNNNNNNGG 1 cut(s) 110
BseNI ACTGG 2 cut(s) 82, 325
BseXI GCAGC 1 cut(s) 163
BsgI GTGCAG 1 cut(s) 87
BshNI GGYRCC 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 54
Bsp143I GATC 1 cut(s) 308
BspLI GGNNCC 1 cut(s) 139
BspPI GGATC 1 cut(s) 316
BspT107I GGYRCC 1 cut(s) 137
BsrI ACTGG 2 cut(s) 82, 325
BssMI GATC 1 cut(s) 308
BstC8I GCNNGC 2 cut(s) 87, 91
BstDEI CTNAG 1 cut(s) 99
BstEII GGTNACC 1 cut(s) 208
BstENI CCTNNNNNAGG 1 cut(s) 108
BstKTI GATC 1 cut(s) 311
BstMAI GTCTC 1 cut(s) 54
BstMBI GATC 1 cut(s) 308
BstNSI RCATGY 2 cut(s) 89, 203
BstPI GGTNACC 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 163
BsuI GTATCC 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 306
BtsIMutI CAGTG 1 cut(s) 306
Cac8I GCNNGC 2 cut(s) 87, 91
Cfr13I GGNCC 1 cut(s) 21
CviAII CATG 3 cut(s) 53, 86, 200
CviJI RGCY 3 cut(s) 103, 121, 237
CviKI_1 RGCY 3 cut(s) 103, 121, 237
DdeI CTNAG 1 cut(s) 99
DpnI GATC 1 cut(s) 310
DpnII GATC 1 cut(s) 308
Eco32I GATATC 1 cut(s) 330
Eco47I GGWCC 1 cut(s) 21
Eco91I GGTNACC 1 cut(s) 208
EcoNI CCTNNNNNAGG 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 21
EcoO65I GGTNACC 1 cut(s) 208
EcoRV GATATC 1 cut(s) 330
FaeI CATG 3 cut(s) 56, 89, 203
FaiI YATR 6 cut(s) 54, 87, 155, 201, 275, 306
FatI CATG 3 cut(s) 52, 85, 199
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
FspBI CTAG 1 cut(s) 122
GluI GCNGC 1 cut(s) 177
GsuI CTGGAG 1 cut(s) 336
Hin1II CATG 3 cut(s) 56, 89, 203
HphI GGTGA 2 cut(s) 220, 236
Hpy188I TCNGA 1 cut(s) 334
Hpy188III TCNNGA 2 cut(s) 283, 353
HpyCH4V TGCA 2 cut(s) 68, 299
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 3 cut(s) 56, 89, 203
Kzo9I GATC 1 cut(s) 308
LpnPI CCDG 7 cut(s) 44, 63, 75, 117, 251, 268, 306
Lsp1109I GCAGC 1 cut(s) 163
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 208
MalI GATC 1 cut(s) 310
MboI GATC 1 cut(s) 308
MboII GAAGA 2 cut(s) 127, 239
MluCI AATT 1 cut(s) 276
MnlI CCTC 5 cut(s) 34, 64, 223, 234, 285
MseI TTAA 2 cut(s) 39, 149
NdeII GATC 1 cut(s) 308
NlaIII CATG 3 cut(s) 56, 89, 203
NlaIV GGNNCC 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 208
NspI RCATGY 2 cut(s) 89, 203
PaeI GCATGC 1 cut(s) 89
PkrI GCNGC 1 cut(s) 178
PpuMI RGGWCCY 1 cut(s) 21
Psp5II RGGWCCY 1 cut(s) 21
PspEI GGTNACC 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 139
PspPI GGNCC 1 cut(s) 21
PspPPI RGGWCCY 1 cut(s) 21
SaqAI TTAA 2 cut(s) 39, 149
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 308
Sau96I GGNCC 1 cut(s) 21
SetI ASST 4 cut(s) 26, 123, 188, 215
SinI GGWCC 1 cut(s) 21
SphI GCATGC 1 cut(s) 89
Sse9I AATT 1 cut(s) 276
SspMI CTAG 1 cut(s) 122
TasI AATT 1 cut(s) 276
Tru1I TTAA 2 cut(s) 39, 149
Tru9I TTAA 2 cut(s) 39, 149
TscAI CASTG 1 cut(s) 306
TseFI GTSAC 1 cut(s) 208
TseI GCWGC 1 cut(s) 176
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 356
TspRI CASTG 1 cut(s) 306
VpaK11BI GGWCC 1 cut(s) 21
XagI CCTNNNNNAGG 1 cut(s) 108
XceI RCATGY 2 cut(s) 89, 203
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.