Rh4DG241500

NHL domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
45146529 .. 45148923
2395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG241500.1

Sequence Viewer

Length: 363 bp
ATGTTAGTGCAGGGGTTACAACACTTGCAGGGGGGATTGGACCAAGTGAAGATGAGAGCATGTAACATGTCATTACCTCATATATTTCTTTTGAAGGATAACATCCCAACCAAGCCTAGATTACCATCAAGCCCATACCAAAAGCCTCTGAAATCCGTCGTGCCACCACTGATTCCAACTGAGGATGAGCAGGAGAAGCAAGAAGAAGGCTTTCTTGGGAACTCTTGTAAAGCTTTTAGTCAACGCGTGTGCATCTATTTTGAAATTCTTGGGAAAAAGCATTCAAACTATCAAAACCAAAGCCAGCAGAAACAGCAGCATAAGCATTCAATTGGGTTCATGTTTAAACCCTTAAAAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.8

Weight (kDa)

9.35

Isoelectric Point (pI)

69.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 246
AcsI RAATTY 1 cut(s) 264
AflIII ACRYGT 2 cut(s) 66, 244
AgsI TTSAA 4 cut(s) 94, 263, 285, 330
AjuI GAANNNNNNNTTGG 2 cut(s) 198, 230
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
ApeKI GCWGC 1 cut(s) 316
ApoI RAATTY 1 cut(s) 264
Asp700I GAANNNNTTC 1 cut(s) 210
AspS9I GGNCC 1 cut(s) 40
AvaII GGWCC 1 cut(s) 40
BbvI GCAGC 1 cut(s) 328
BccI CCATC 1 cut(s) 133
BfaI CTAG 1 cut(s) 117
BisI GCNGC 1 cut(s) 317
BlsI GCNGC 1 cut(s) 318
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BmsI GCATC 1 cut(s) 261
BsaBI GATNNNNATC 1 cut(s) 124
Bse8I GATNNNNATC 1 cut(s) 124
BseGI GGATG 2 cut(s) 102, 190
BseJI GATNNNNATC 1 cut(s) 124
BseMII CTCAG 1 cut(s) 171
BseXI GCAGC 1 cut(s) 328
BsgI GTGCAG 1 cut(s) 29
Bsh1236I CGCG 1 cut(s) 246
BsmI GAATGC 2 cut(s) 280, 325
BspCNI CTCAG 1 cut(s) 172
BspFNI CGCG 1 cut(s) 246
BstC8I GCNNGC 1 cut(s) 305
BstDEI CTNAG 1 cut(s) 180
BstF5I GGATG 2 cut(s) 102, 190
BstFNI CGCG 1 cut(s) 246
BstMWI GCNNNNNNNGC 3 cut(s) 196, 313, 322
BstNSI RCATGY 2 cut(s) 63, 70
BstUI CGCG 1 cut(s) 246
BstV1I GCAGC 1 cut(s) 328
BtsCI GGATG 2 cut(s) 102, 190
BtsIMutI CAGTG 1 cut(s) 167
Cac8I GCNNGC 1 cut(s) 305
Cfr13I GGNCC 1 cut(s) 40
CviAII CATG 3 cut(s) 60, 67, 340
CviJI RGCY 6 cut(s) 115, 132, 145, 210, 233, 303
CviKI_1 RGCY 6 cut(s) 115, 132, 145, 210, 233, 303
DdeI CTNAG 1 cut(s) 180
DraI TTTAAA 1 cut(s) 346
Eco47I GGWCC 1 cut(s) 40
FaeI CATG 3 cut(s) 63, 70, 343
FaiI YATR 7 cut(s) 61, 68, 81, 83, 136, 321, 341
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FatI CATG 3 cut(s) 59, 66, 339
Fnu4HI GCNGC 1 cut(s) 317
FokI GGATG 2 cut(s) 89, 197
Fsp4HI GCNGC 1 cut(s) 317
FspBI CTAG 1 cut(s) 117
GluI GCNGC 1 cut(s) 317
Hin1II CATG 3 cut(s) 63, 70, 343
HincII GTYRAC 1 cut(s) 242
HindII GTYRAC 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 231
HinfI GANTC 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 242
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 88, 200
HpyCH4V TGCA 3 cut(s) 10, 28, 252
HpyF10VI GCNNNNNNNGC 3 cut(s) 196, 313, 322
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 3 cut(s) 63, 70, 343
LpnPI CCDG 3 cut(s) 14, 176, 317
Lsp1109I GCAGC 1 cut(s) 328
LweI GCATC 1 cut(s) 261
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 15, 62
MboII GAAGA 2 cut(s) 61, 215
MfeI CAATTG 1 cut(s) 330
MluCI AATT 2 cut(s) 264, 330
MluI ACGCGT 1 cut(s) 244
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 3 cut(s) 87, 156, 175
MroXI GAANNNNTTC 1 cut(s) 210
MseI TTAA 2 cut(s) 345, 353
MssI GTTTAAAC 1 cut(s) 346
MunI CAATTG 1 cut(s) 330
Mva1269I GAATGC 2 cut(s) 280, 325
MvnI CGCG 1 cut(s) 246
MwoI GCNNNNNNNGC 3 cut(s) 196, 313, 322
NlaIII CATG 3 cut(s) 63, 70, 343
NspI RCATGY 2 cut(s) 63, 70
PciI ACATGT 1 cut(s) 66
PctI GAATGC 2 cut(s) 280, 325
PdmI GAANNNNTTC 1 cut(s) 210
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 1 cut(s) 318
PmeI GTTTAAAC 1 cut(s) 346
PscI ACATGT 1 cut(s) 66
PspPI GGNCC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 345, 353
SatI GCNGC 1 cut(s) 317
Sau96I GGNCC 1 cut(s) 40
SetI ASST 2 cut(s) 79, 235
SfaNI GCATC 1 cut(s) 261
SinI GGWCC 1 cut(s) 40
Sse9I AATT 2 cut(s) 264, 330
SspMI CTAG 1 cut(s) 117
TasI AATT 2 cut(s) 264, 330
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 2 cut(s) 345, 353
Tru9I TTAA 2 cut(s) 345, 353
TscAI CASTG 1 cut(s) 174
TseI GCWGC 1 cut(s) 316
TspDTI ATGAA 1 cut(s) 328
TspGWI ACGGA 1 cut(s) 145
TspRI CASTG 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 40
XapI RAATTY 1 cut(s) 264
XceI RCATGY 2 cut(s) 63, 70
XmnI GAANNNNTTC 1 cut(s) 210
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.