RLG00000013428

Exocyst complex component Sec6

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
31380429 .. 31381820
1392 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000013428

Sequence Viewer

Length: 351 bp
ATGGCCTTATTTAAGAAAGCTCAGGTATCCCATCATAGGTCATGGACTAAACTTGGAGTTATGACAGCTTCTCAGCGCAATATAAGGCTATGTCAAGAATGCCAAACTTTGATTGAAAACCATGATAAGATAAAGCTTCTTAGCAATGCTAGGAATAACTTGAATACAACCTTAAAGGGGTTACAACAATTGCAGGGGGAATTGGACCAAGTGAAGATGAGAGCATGTAACATGTCATTGCCTTTTATATTTGTTTTGAAGGATGAAGTCCCAACCAAGCCAAGATTGCCATCAAGTCCATACCAAAAGCCTCTGAAATCAGTCTTGCCACCACTGATTTCAAGAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.31

Weight (kDa)

10.3

Isoelectric Point (pI)

56.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 36, 177
AflIII ACRYGT 1 cut(s) 231
AgsI TTSAA 4 cut(s) 116, 163, 259, 342
AluBI AGCT 3 cut(s) 20, 68, 136
AluI AGCT 3 cut(s) 20, 68, 136
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 205
AvaII GGWCC 1 cut(s) 205
BccI CCATC 2 cut(s) 39, 298
BciVI GTATCC 1 cut(s) 37
BfaI CTAG 1 cut(s) 150
BfuI GTATCC 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
Bpu10I CCTNAGC 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 289
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 177
Bse3DI GCAATG 2 cut(s) 151, 236
Bse8I GATNNNNATC 1 cut(s) 289
BseGI GGATG 1 cut(s) 268
BseJI GATNNNNATC 1 cut(s) 289
BseLI CCNNNNNNNGG 2 cut(s) 36, 177
BseMI GCAATG 2 cut(s) 151, 236
BseMII CTCAG 2 cut(s) 35, 86
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 254
BslI CCNNNNNNNGG 2 cut(s) 36, 177
BsmFI GGGAC 1 cut(s) 254
BsmI GAATGC 1 cut(s) 104
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 34, 85
BsrDI GCAATG 2 cut(s) 151, 236
BstDEI CTNAG 3 cut(s) 21, 72, 140
BstF5I GGATG 1 cut(s) 268
BstHHI GCGC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 286
BstNSI RCATGY 2 cut(s) 228, 235
BsuI GTATCC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 268
BtsIMutI CAGTG 1 cut(s) 332
CfoI GCGC 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 205
CviAII CATG 4 cut(s) 42, 122, 225, 232
CviJI RGCY 7 cut(s) 5, 20, 68, 88, 136, 280, 310
CviKI_1 RGCY 7 cut(s) 5, 20, 68, 88, 136, 280, 310
DdeI CTNAG 3 cut(s) 21, 72, 140
Eco47I GGWCC 1 cut(s) 205
FaeI CATG 4 cut(s) 45, 125, 228, 235
FaqI GGGAC 1 cut(s) 254
FatI CATG 4 cut(s) 41, 121, 224, 231
FokI GGATG 1 cut(s) 275
FspBI CTAG 1 cut(s) 150
GlaI GCGC 1 cut(s) 77
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 78
Hin1II CATG 4 cut(s) 45, 125, 228, 235
Hin6I GCGC 1 cut(s) 76
HinP1I GCGC 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 315
Hpy188III TCNNGA 2 cut(s) 95, 342
HpyAV CCTTC 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 193
HpyF10VI GCNNNNNNNGC 1 cut(s) 286
HpyF3I CTNAG 3 cut(s) 21, 72, 140
Hsp92II CATG 4 cut(s) 45, 125, 228, 235
HspAI GCGC 1 cut(s) 76
LpnPI CCDG 2 cut(s) 8, 179
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 2 cut(s) 180, 227
MboII GAAGA 1 cut(s) 226
MfeI CAATTG 1 cut(s) 188
MluCI AATT 2 cut(s) 188, 200
MnlI CCTC 1 cut(s) 321
MseI TTAA 2 cut(s) 12, 173
MunI CAATTG 1 cut(s) 188
Mva1269I GAATGC 1 cut(s) 104
MwoI GCNNNNNNNGC 1 cut(s) 286
NlaIII CATG 4 cut(s) 45, 125, 228, 235
NspI RCATGY 2 cut(s) 228, 235
PciI ACATGT 1 cut(s) 231
PctI GAATGC 1 cut(s) 104
PscI ACATGT 1 cut(s) 231
PspPI GGNCC 1 cut(s) 205
SaqAI TTAA 2 cut(s) 12, 173
Sau96I GGNCC 1 cut(s) 205
SetI ASST 6 cut(s) 22, 27, 41, 70, 138, 173
SinI GGWCC 1 cut(s) 205
Sse9I AATT 2 cut(s) 188, 200
SspMI CTAG 1 cut(s) 150
TasI AATT 2 cut(s) 188, 200
Tru1I TTAA 2 cut(s) 12, 173
Tru9I TTAA 2 cut(s) 12, 173
TscAI CASTG 1 cut(s) 339
TspDTI ATGAA 1 cut(s) 279
TspRI CASTG 1 cut(s) 339
VpaK11BI GGWCC 1 cut(s) 205
XceI RCATGY 2 cut(s) 228, 235
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.