Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8340297.1

Orthogroup ID

OG0008171

Physical Location & Seq

Genomic Coordinates Reverse (-)

296 .. 910

Gene Structure 615 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8340297.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

atgccgtcaagtccatacaaaaagcctctgaaatcagtcatgccaccactgattccaactgaagatgagcaggagaagcaagaagaaggcttctttggatcacttggaaagcttttagtcaatgcctgggcatctattttggaaattcttgggaaaaagcattcaaactatcaagaccaaagccagcagcaacagcagcacaagcattcaaatacttggcctgtgcaagatagttatgtgatagcagatgaggatgagccgcctacaattgacacccgaacccctaccccacgcaaaacctatgcgtttatggccaaggatgctgaaacaatgcaacagttgcgacaaagccgagttttctacaatgggtggggtgatcatcaacagcagccaaaacagcagcagcattatcatcgtcaccagtcatccacttcacaaactttctatgagcagagctgtgatcaaaccactgagattgtgtttggggcagtccaggagcaggatgggaagggtgaagctgtggtcattaagcctattgattatggagatcccatgcttggtcatcgcagtgttaactaccgattcaatgcaatgggttatccccgtggttattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NHL

Protein Analysis

204

Amino Acids

23.52

Weight (kDa)

6.05

Isoelectric Point (pI)

69.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008171)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0330481 RchiOBHm_Chr1g0343121 RchiOBHm_Chr5g0006981 RchiOBHm_Chr7g0228441
rosa_laevigata	RLG00000009218 RLG00000013428 RLG00000023422 RLG00000028878
rosa_multiflora	Rmu_co8340297.1_g000001 Rmu_sc0027157.1_g000001
rosa_roxburghii	Rroxscaffold_1G00071520 Rroxscaffold_7G00192850
rosa_rugosa	Rorug05G0375200
rosa_samantha	Rh2CG409900 Rh2DG353000 Rh3BG332600 Rh3DG311700 Rh4DG241500 Rh5AG153900 Rh5AG364100 Rh6AG240500 Rh6BG135500 Rh7CG472600 Rh7DG441600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	260
AclWI	GGATC	2 cut(s)	106, 542
AcoI	YGGCCR	1 cut(s)	312
AcsI	RAATTY	1 cut(s)	144
AcuI	CTGAAG	1 cut(s)	81
AfiI	CCNNNNNNNGG	2 cut(s)	499, 557
AgsI	TTSAA	3 cut(s)	165, 210, 586
AjnI	CCWGG	2 cut(s)	125, 492
AjuI	GAANNNNNNNTTGG	2 cut(s)	78, 110
AluBI	AGCT	3 cut(s)	112, 456, 518
AluI	AGCT	3 cut(s)	112, 456, 518
AlwI	GGATC	2 cut(s)	106, 542
AoxI	GGCC	2 cut(s)	218, 312
ApeKI	GCWGC	5 cut(s)	187, 196, 388, 400, 403
ApoI	RAATTY	1 cut(s)	144
AsuHPI	GGTGA	3 cut(s)	386, 410, 524
BalI	TGGCCA	1 cut(s)	314
BbvI	GCAGC	5 cut(s)	199, 208, 400, 412, 415
BccI	CCATC	1 cut(s)	497
BcgI	CGANNNNNNTGC	2 cut(s)	395, 429
BciT130I	CCWGG	2 cut(s)	127, 494
BclI	TGATCA	2 cut(s)	376, 460
BisI	GCNGC	6 cut(s)	188, 197, 260, 389, 401, 404
BlsI	GCNGC	6 cut(s)	189, 198, 261, 390, 402, 405
Bme1390I	CCNGG	2 cut(s)	127, 494
BmrFI	CCNGG	2 cut(s)	127, 494
BmsI	GCATC	2 cut(s)	140, 310
BsaJI	CCNNGG	3 cut(s)	126, 315, 604
Bsc4I	CCNNNNNNNGG	2 cut(s)	499, 557
Bse1I	ACTGG	1 cut(s)	421
Bse3DI	GCAATG	1 cut(s)	597
BseBI	CCWGG	2 cut(s)	127, 494
BseDI	CCNNGG	3 cut(s)	126, 315, 604
BseGI	GGATG	4 cut(s)	259, 325, 425, 508
BseLI	CCNNNNNNNGG	2 cut(s)	499, 557
BseMI	GCAATG	1 cut(s)	597
BseMII	CTCAG	1 cut(s)	462
BseNI	ACTGG	1 cut(s)	421
BseXI	GCAGC	5 cut(s)	199, 208, 400, 412, 415
BshFI	GGCC	2 cut(s)	220, 314
BslI	CCNNNNNNNGG	2 cut(s)	499, 557
BsmI	GAATGC	2 cut(s)	160, 205
BsnI	GGCC	2 cut(s)	220, 314
Bsp143I	GATC	4 cut(s)	98, 376, 460, 547
BspACI	CCGC	1 cut(s)	260
BspANI	GGCC	2 cut(s)	220, 314
BspCNI	CTCAG	1 cut(s)	463
BspPI	GGATC	2 cut(s)	106, 542
BsrDI	GCAATG	1 cut(s)	597
BsrI	ACTGG	1 cut(s)	421
BssECI	CCNNGG	3 cut(s)	126, 315, 604
BssMI	GATC	4 cut(s)	98, 376, 460, 547
BssT1I	CCWWGG	1 cut(s)	315
Bst2UI	CCWGG	2 cut(s)	127, 494
Bst4CI	ACNGT	1 cut(s)	339
BstAPI	GCANNNNNTGC	1 cut(s)	340
BstC8I	GCNNGC	1 cut(s)	185
BstDEI	CTNAG	1 cut(s)	471
BstDSI	CCRYGG	1 cut(s)	604
BstF5I	GGATG	4 cut(s)	259, 325, 425, 508
BstKTI	GATC	4 cut(s)	101, 379, 463, 550
BstMBI	GATC	4 cut(s)	98, 376, 460, 547
BstMWI	GCNNNNNNNGC	8 cut(s)	76, 193, 196, 202, 311, 320, 340, 397
BstNI	CCWGG	2 cut(s)	127, 494
BstSCI	CCNGG	2 cut(s)	125, 492
BstV1I	GCAGC	5 cut(s)	199, 208, 400, 412, 415
BstX2I	RGATCY	1 cut(s)	547
BstYI	RGATCY	1 cut(s)	547
BsuRI	GGCC	2 cut(s)	220, 314
BtgI	CCRYGG	1 cut(s)	604
BtgZI	GCGATG	1 cut(s)	548
BtsCI	GGATG	4 cut(s)	259, 325, 425, 508
BtsI	GCAGTG	1 cut(s)	574
BtsIMutI	CAGTG	3 cut(s)	47, 468, 574
Cac8I	GCNNGC	1 cut(s)	185
CspCI	CAANNNNNGTGG	2 cut(s)	457, 492
CviAII	CATG	2 cut(s)	40, 553
DdeI	CTNAG	1 cut(s)	471
DpnI	GATC	4 cut(s)	100, 378, 462, 549
DpnII	GATC	4 cut(s)	98, 376, 460, 547
EaeI	YGGCCR	1 cut(s)	312
Eco130I	CCWWGG	1 cut(s)	315
Eco57I	CTGAAG	1 cut(s)	81
EcoRII	CCWGG	2 cut(s)	125, 492
EcoT14I	CCWWGG	1 cut(s)	315
ErhI	CCWWGG	1 cut(s)	315
FaeI	CATG	2 cut(s)	43, 556
FaiI	YATR	8 cut(s)	16, 41, 237, 303, 311, 447, 543, 554
FatI	CATG	2 cut(s)	39, 552
FbaI	TGATCA	2 cut(s)	376, 460
Fnu4HI	GCNGC	6 cut(s)	188, 197, 260, 389, 401, 404
FokI	GGATG	4 cut(s)	266, 332, 412, 515
Fsp4HI	GCNGC	6 cut(s)	188, 197, 260, 389, 401, 404
GluI	GCNGC	6 cut(s)	188, 197, 260, 389, 401, 404
HaeIII	GGCC	2 cut(s)	220, 314
Hin1II	CATG	2 cut(s)	43, 556
HincII	GTYRAC	1 cut(s)	574
HindII	GTYRAC	1 cut(s)	574
HindIII	AAGCTT	1 cut(s)	110
HinfI	GANTC	2 cut(s)	52, 582
HpaI	GTTAAC	1 cut(s)	574
HphI	GGTGA	3 cut(s)	386, 410, 524
Hpy166II	GTNNAC	1 cut(s)	574
Hpy188I	TCNGA	1 cut(s)	30
Hpy188III	TCNNGA	1 cut(s)	173
Hpy8I	GTNNAC	1 cut(s)	574
HpyAV	CCTTC	2 cut(s)	80, 502
HpyCH4III	ACNGT	1 cut(s)	339
HpyCH4V	TGCA	3 cut(s)	226, 334, 590
HpyF10VI	GCNNNNNNNGC	8 cut(s)	76, 193, 196, 202, 311, 320, 340, 397
HpyF3I	CTNAG	1 cut(s)	471
Hsp92II	CATG	2 cut(s)	43, 556
Ksp22I	TGATCA	2 cut(s)	376, 460
KspAI	GTTAAC	1 cut(s)	574
Kzo9I	GATC	4 cut(s)	98, 376, 460, 547
LmnI	GCTCC	1 cut(s)	496
LpnPI	CCDG	9 cut(s)	56, 112, 139, 197, 234, 434, 479, 485, 506
Lsp1109I	GCAGC	5 cut(s)	199, 208, 400, 412, 415
LweI	GCATC	2 cut(s)	140, 310
MaeIII	GTNAC	1 cut(s)	416
MalI	GATC	4 cut(s)	100, 378, 462, 549
MboI	GATC	4 cut(s)	98, 376, 460, 547
MboII	GAAGA	2 cut(s)	74, 95
MfeI	CAATTG	1 cut(s)	267
MflI	RGATCY	1 cut(s)	547
MlsI	TGGCCA	1 cut(s)	314
MluCI	AATT	2 cut(s)	144, 267
MluNI	TGGCCA	1 cut(s)	314
MmeI	TCCRAC	1 cut(s)	80
MnlI	CCTC	2 cut(s)	36, 244
Mox20I	TGGCCA	1 cut(s)	314
MscI	TGGCCA	1 cut(s)	314
MseI	TTAA	2 cut(s)	528, 573
MslI	CAYNNNNRTG	1 cut(s)	567
Msp20I	TGGCCA	1 cut(s)	314
MspR9I	CCNGG	2 cut(s)	127, 494
MunI	CAATTG	1 cut(s)	267
Mva1269I	GAATGC	2 cut(s)	160, 205
MvaI	CCWGG	2 cut(s)	127, 494
MwoI	GCNNNNNNNGC	8 cut(s)	76, 193, 196, 202, 311, 320, 340, 397
NdeII	GATC	4 cut(s)	98, 376, 460, 547
NlaIII	CATG	2 cut(s)	43, 556
NmeAIII	GCCGAG	1 cut(s)	377
NmuCI	GTSAC	1 cut(s)	416
PctI	GAATGC	2 cut(s)	160, 205
PfeI	GAWTC	2 cut(s)	52, 582
PfoI	TCCNGGA	1 cut(s)	492
PkrI	GCNGC	6 cut(s)	189, 198, 261, 390, 402, 405
Psp6I	CCWGG	2 cut(s)	125, 492
PspGI	CCWGG	2 cut(s)	125, 492
PsuI	RGATCY	1 cut(s)	547
RseI	CAYNNNNRTG	1 cut(s)	567
SaqAI	TTAA	2 cut(s)	528, 573
SatI	GCNGC	6 cut(s)	188, 197, 260, 389, 401, 404
Sau3AI	GATC	4 cut(s)	98, 376, 460, 547
ScrFI	CCNGG	2 cut(s)	127, 494
SetI	ASST	4 cut(s)	114, 302, 458, 520
SfaNI	GCATC	2 cut(s)	140, 310
SmiMI	CAYNNNNRTG	1 cut(s)	567
Sse9I	AATT	2 cut(s)	144, 267
SsiI	CCGC	1 cut(s)	260
StyD4I	CCNGG	2 cut(s)	125, 492
StyI	CCWWGG	1 cut(s)	315
TaaI	ACNGT	1 cut(s)	339
TasI	AATT	2 cut(s)	144, 267
TauI	GCSGC	1 cut(s)	262
TfiI	GAWTC	2 cut(s)	52, 582
Tru1I	TTAA	2 cut(s)	528, 573
Tru9I	TTAA	2 cut(s)	528, 573
TscAI	CASTG	3 cut(s)	54, 475, 574
TseFI	GTSAC	1 cut(s)	416
TseI	GCWGC	5 cut(s)	187, 196, 388, 400, 403
Tsp45I	GTSAC	1 cut(s)	416
TspRI	CASTG	3 cut(s)	54, 475, 574
XapI	RAATTY	1 cut(s)	144
XcmI	CCANNNNNNNNNTGG	1 cut(s)	500

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.