Rh2CG409900

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
55809860 .. 55812403
2544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG409900.1

Sequence Viewer

Length: 241 bp
ATGGCCTTATTCAAGAAGGCTCAGGTATCCCATCACAGGTCATGGACTAAACTTGGAGTTATGACAGCTTCTCAGCGCAATATAAGGCTATGTCAAGAATGCCAAACTTTGATTGAAAACCATACTAAGATAAAGCTTCTCAGCAATGTGAGGAATAACTTGAATACAACCTTAAAGGTTTATGAACTTTGTTCTCATGAATTTTCAGTTTTCGGTTCACAAAGAGAAGGAGATTGTGCAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.19

Weight (kDa)

9.34

Isoelectric Point (pI)

26.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 3 cut(s) 13, 116, 163
AluBI AGCT 2 cut(s) 68, 136
AluI AGCT 2 cut(s) 68, 136
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 200
AspLEI GCGC 1 cut(s) 78
BccI CCATC 1 cut(s) 39
BciVI GTATCC 1 cut(s) 37
BfuI GTATCC 1 cut(s) 37
Bpu10I CCTNAGC 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse3DI GCAATG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 3 cut(s) 35, 86, 154
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 36
BsmI GAATGC 1 cut(s) 104
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 3 cut(s) 34, 85, 153
BspHI TCATGA 1 cut(s) 196
BsrDI GCAATG 1 cut(s) 151
BstDEI CTNAG 4 cut(s) 21, 72, 126, 140
BstHHI GCGC 1 cut(s) 78
BsuI GTATCC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 5
CciI TCATGA 1 cut(s) 196
CfoI GCGC 1 cut(s) 78
CviAII CATG 2 cut(s) 42, 197
CviJI RGCY 5 cut(s) 5, 20, 68, 88, 136
CviKI_1 RGCY 5 cut(s) 5, 20, 68, 88, 136
DdeI CTNAG 4 cut(s) 21, 72, 126, 140
FaeI CATG 2 cut(s) 45, 200
FaiI YATR 7 cut(s) 43, 62, 83, 91, 123, 183, 198
FatI CATG 2 cut(s) 41, 196
GlaI GCGC 1 cut(s) 77
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 78
Hin1II CATG 2 cut(s) 45, 200
Hin6I GCGC 1 cut(s) 76
HinP1I GCGC 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 218
Hpy188III TCNNGA 3 cut(s) 13, 95, 197
Hpy8I GTNNAC 1 cut(s) 218
HpyAV CCTTC 2 cut(s) 10, 221
HpyCH4V TGCA 1 cut(s) 239
HpyF3I CTNAG 4 cut(s) 21, 72, 126, 140
Hsp92II CATG 2 cut(s) 45, 200
HspAI GCGC 1 cut(s) 76
LpnPI CCDG 2 cut(s) 8, 22
MluCI AATT 1 cut(s) 200
MnlI CCTC 1 cut(s) 144
MseI TTAA 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 104
NlaIII CATG 2 cut(s) 45, 200
PagI TCATGA 1 cut(s) 196
PctI GAATGC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 173
SetI ASST 6 cut(s) 27, 41, 70, 138, 173, 180
SgeI CNNG 8 cut(s) 25, 35, 49, 54, 65, 107, 172, 209
Sse9I AATT 1 cut(s) 200
TasI AATT 1 cut(s) 200
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TspDTI ATGAA 2 cut(s) 198, 213
XapI RAATTY 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.