RLG00000009218

NHL domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Reverse (-)
49049551 .. 49051151
1601 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000009218

Sequence Viewer

Length: 438 bp
ATGCTGCTGAATGACAAAGTCGGAAATCTGGAGGACGTTATTTTAGCTCTCGGTGATGACATTATAGTTTCTCGTGCTACATTGACACCCAATTTTAGCTATCGTGTTAAATCCCCACTCAATTTCATGTCTTGCATTGACATTGTAGTCTCAAGTGCTATGGTTGCATGTGTTCTGGACTTTCATGGTCATTTAAAAAGCTTGCTCGCACTGACCAATTCATTGATTAAGTGTGAGAATTCACTTGACTATGCAACCTTAGGGGCATCATCGAAAGTTGCTGCCATTACTCTATCATATCCATTCCAGATAAAGCTTCTTAGCAATGCGAGGAATAACTTGAATACAACCTTAAAGGATGAAGTCCCAACCAAGCCAAGATTGCCATCAAGTCCATACCCAAAGCCTCTGAAATCAGTCGTGCCACCACTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

15.74

Weight (kDa)

8.81

Isoelectric Point (pI)

27.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 146
AcsI RAATTY 1 cut(s) 238
AgsI TTSAA 1 cut(s) 343
AluBI AGCT 4 cut(s) 47, 99, 201, 316
AluI AGCT 4 cut(s) 47, 99, 201, 316
Alw26I GTCTC 1 cut(s) 154
ApeKI GCWGC 2 cut(s) 4, 281
ApoI RAATTY 1 cut(s) 238
AsuHPI GGTGA 1 cut(s) 65
AxyI CCTNAGG 1 cut(s) 259
BauI CACGAG 1 cut(s) 72
BbvI GCAGC 1 cut(s) 268
BccI CCATC 1 cut(s) 394
BcoDI GTCTC 1 cut(s) 154
BisI GCNGC 2 cut(s) 5, 282
BlsI GCNGC 2 cut(s) 6, 283
BmsI GCATC 1 cut(s) 275
BpmI CTGGAG 1 cut(s) 50
BpuEI CTTGAG 1 cut(s) 136
BsaBI GATNNNNATC 1 cut(s) 385
Bse21I CCTNAGG 1 cut(s) 259
Bse3DI GCAATG 1 cut(s) 331
Bse8I GATNNNNATC 1 cut(s) 385
BseGI GGATG 1 cut(s) 364
BseJI GATNNNNATC 1 cut(s) 385
BseMI GCAATG 1 cut(s) 331
BseXI GCAGC 1 cut(s) 268
BslFI GGGAC 1 cut(s) 350
BsmAI GTCTC 1 cut(s) 154
BsmFI GGGAC 1 cut(s) 350
BsrDI GCAATG 1 cut(s) 331
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
BstC8I GCNNGC 2 cut(s) 203, 207
BstDEI CTNAG 2 cut(s) 259, 320
BstF5I GGATG 1 cut(s) 364
BstMAI GTCTC 1 cut(s) 154
BstMWI GCNNNNNNNGC 3 cut(s) 164, 382, 430
BstNSI RCATGY 1 cut(s) 171
BstV1I GCAGC 1 cut(s) 268
Bsu36I CCTNAGG 1 cut(s) 259
BtsCI GGATG 1 cut(s) 364
BtsI GCAGTG 1 cut(s) 428
BtsIMutI CAGTG 2 cut(s) 209, 428
Cac8I GCNNGC 2 cut(s) 203, 207
CviAII CATG 3 cut(s) 127, 168, 185
CviJI RGCY 6 cut(s) 47, 99, 201, 316, 376, 406
CviKI_1 RGCY 6 cut(s) 47, 99, 201, 316, 376, 406
DdeI CTNAG 2 cut(s) 259, 320
DraI TTTAAA 1 cut(s) 195
DrdI GACNNNNNNGTC 1 cut(s) 146
DseDI GACNNNNNNGTC 1 cut(s) 146
Eco81I CCTNAGG 1 cut(s) 259
EcoRI GAATTC 1 cut(s) 238
FaeI CATG 3 cut(s) 130, 171, 188
FaiI YATR 8 cut(s) 65, 128, 161, 169, 186, 252, 298, 397
FaqI GGGAC 1 cut(s) 350
FatI CATG 3 cut(s) 126, 167, 184
Fnu4HI GCNGC 2 cut(s) 5, 282
FokI GGATG 1 cut(s) 371
Fsp4HI GCNGC 2 cut(s) 5, 282
GluI GCNGC 2 cut(s) 5, 282
GsuI CTGGAG 1 cut(s) 50
Hin1II CATG 3 cut(s) 130, 171, 188
HindIII AAGCTT 2 cut(s) 199, 314
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 2 cut(s) 23, 411
Hpy188III TCNNGA 3 cut(s) 29, 176, 307
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 3 cut(s) 135, 167, 254
HpyF10VI GCNNNNNNNGC 3 cut(s) 164, 382, 430
HpyF3I CTNAG 2 cut(s) 259, 320
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 3 cut(s) 130, 171, 188
LpnPI CCDG 3 cut(s) 14, 161, 320
Lsp1109I GCAGC 1 cut(s) 268
LweI GCATC 1 cut(s) 275
MaeII ACGT 1 cut(s) 36
MluCI AATT 4 cut(s) 91, 121, 217, 238
MnlI CCTC 3 cut(s) 25, 324, 417
MseI TTAA 4 cut(s) 108, 194, 228, 353
MwoI GCNNNNNNNGC 3 cut(s) 164, 382, 430
NlaIII CATG 3 cut(s) 130, 171, 188
NspI RCATGY 1 cut(s) 171
PflFI GACNNNGTC 1 cut(s) 17
PkrI GCNGC 2 cut(s) 6, 283
PsyI GACNNNGTC 1 cut(s) 17
SaqAI TTAA 4 cut(s) 108, 194, 228, 353
SatI GCNGC 2 cut(s) 5, 282
SetI ASST 7 cut(s) 39, 49, 101, 203, 260, 318, 353
SfaNI GCATC 1 cut(s) 275
SmlI CTYRAG 1 cut(s) 151
SmoI CTYRAG 1 cut(s) 151
Sse9I AATT 4 cut(s) 91, 121, 217, 238
TaiI ACGT 1 cut(s) 39
TaqI TCGA 1 cut(s) 272
TasI AATT 4 cut(s) 91, 121, 217, 238
Tru1I TTAA 4 cut(s) 108, 194, 228, 353
Tru9I TTAA 4 cut(s) 108, 194, 228, 353
TscAI CASTG 2 cut(s) 216, 435
TseI GCWGC 2 cut(s) 4, 281
TspDTI ATGAA 4 cut(s) 115, 173, 210, 375
TspRI CASTG 2 cut(s) 216, 435
Tth111I GACNNNGTC 1 cut(s) 17
XapI RAATTY 1 cut(s) 238
XceI RCATGY 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.