Rh7DG441600

Nudix hydrolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
62711717 .. 62713302
1586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG441600.1

Sequence Viewer

Length: 273 bp
ATGCTCGTCTATTGGATTCCCAAGTCTGCTTATACTCTCCCTGAAAACACTACACACCTGCTCAAAATTGGTGCTTTTGTAATCAATCAAAGCAGAGAGAATTCACTTGACTATGCAACCTTAGGGGCATCATCGAAAGTTGCTGCCATACCTCTATCATATCCATTACAGTTCTTTTCTAGTAACCCCTTCTGTCTTGCAAGAAAGTGGTTTGCTGCAGGTAGAACAAGTGCAAGCAGTTGGAATCCCTTGTCTTGTCTCAAAAATCAATAA

Protein Analysis

90

Amino Acids

10.0

Weight (kDa)

9.57

Isoelectric Point (pI)

33.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 66
Acc36I ACCTGC 2 cut(s) 66, 209
AcsI RAATTY 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 263
ApeKI GCWGC 2 cut(s) 143, 215
ApoI RAATTY 1 cut(s) 100
AxyI CCTNAGG 1 cut(s) 121
BbvI GCAGC 2 cut(s) 130, 202
BcoDI GTCTC 1 cut(s) 263
BfaI CTAG 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 216
BfuAI ACCTGC 2 cut(s) 66, 209
BisI GCNGC 2 cut(s) 144, 216
BlsI GCNGC 2 cut(s) 145, 217
BmsI GCATC 1 cut(s) 137
Bse21I CCTNAGG 1 cut(s) 121
BseXI GCAGC 2 cut(s) 130, 202
BsmAI GTCTC 1 cut(s) 263
BspMAI CTGCAG 1 cut(s) 220
BspMI ACCTGC 2 cut(s) 66, 209
Bst4CI ACNGT 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 235
BstDEI CTNAG 1 cut(s) 121
BstMAI GTCTC 1 cut(s) 263
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 2 cut(s) 130, 202
Bsu36I CCTNAGG 1 cut(s) 121
BveI ACCTGC 2 cut(s) 66, 209
Cac8I GCNNGC 1 cut(s) 235
DdeI CTNAG 1 cut(s) 121
Eco81I CCTNAGG 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 100
FaiI YATR 4 cut(s) 33, 114, 149, 160
Fnu4HI GCNGC 2 cut(s) 144, 216
Fsp4HI GCNGC 2 cut(s) 144, 216
FspBI CTAG 1 cut(s) 180
GluI GCNGC 2 cut(s) 144, 216
HinfI GANTC 2 cut(s) 16, 244
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 171
HpyCH4V TGCA 4 cut(s) 116, 200, 218, 233
HpyF3I CTNAG 1 cut(s) 121
LpnPI CCDG 3 cut(s) 54, 71, 204
Lsp1109I GCAGC 2 cut(s) 130, 202
LweI GCATC 1 cut(s) 137
MaeI CTAG 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 182
MluCI AATT 2 cut(s) 66, 100
MmeI TCCRAC 1 cut(s) 221
MnlI CCTC 1 cut(s) 162
PaqCI CACCTGC 1 cut(s) 66
PfeI GAWTC 2 cut(s) 16, 244
PkrI GCNGC 2 cut(s) 145, 217
PstI CTGCAG 1 cut(s) 220
SatI GCNGC 2 cut(s) 144, 216
SetI ASST 4 cut(s) 60, 122, 154, 223
SfaNI GCATC 1 cut(s) 137
SfcI CTRYAG 1 cut(s) 216
Sse9I AATT 2 cut(s) 66, 100
SspMI CTAG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 171
TaqI TCGA 1 cut(s) 134
TasI AATT 2 cut(s) 66, 100
TfiI GAWTC 2 cut(s) 16, 244
TseI GCWGC 2 cut(s) 143, 215
XapI RAATTY 1 cut(s) 100
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.