Rh5AG153900

Exocyst complex component Sec6

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
16210432 .. 16226507
16076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG153900.1

Sequence Viewer

Length: 210 bp
ATGGCCTTATTCAAGAAGGCTCAGGTATCCCATCACAGGTCATGGACTAAACTTGGAGTTATGACAGCTTCTCAGCGCAATATAAGGCTATGTCAAGAATGCCAAACTTTGATTGAAAACCATTCTAAGATAAAGCTTCTCAGCAATGTGAGGAATAACTTGAATACAACCTTAAAGTGGCCAAAAAACCTGATCATTTTTTATGAAAAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.27

Weight (kDa)

10.3

Isoelectric Point (pI)

34.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 179
AfiI CCNNNNNNNGG 2 cut(s) 36, 177
AgsI TTSAA 3 cut(s) 13, 116, 163
AluBI AGCT 2 cut(s) 68, 136
AluI AGCT 2 cut(s) 68, 136
AoxI GGCC 2 cut(s) 3, 179
AspLEI GCGC 1 cut(s) 78
BalI TGGCCA 1 cut(s) 181
BccI CCATC 1 cut(s) 39
BciVI GTATCC 1 cut(s) 37
BclI TGATCA 1 cut(s) 192
BfuI GTATCC 1 cut(s) 37
Bpu10I CCTNAGC 1 cut(s) 21
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 177
Bse3DI GCAATG 1 cut(s) 151
BseLI CCNNNNNNNGG 2 cut(s) 36, 177
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 3 cut(s) 35, 86, 154
BshFI GGCC 2 cut(s) 5, 181
BslI CCNNNNNNNGG 2 cut(s) 36, 177
BsmI GAATGC 1 cut(s) 104
BsnI GGCC 2 cut(s) 5, 181
Bsp143I GATC 1 cut(s) 192
BspANI GGCC 2 cut(s) 5, 181
BspCNI CTCAG 3 cut(s) 34, 85, 153
BsrDI GCAATG 1 cut(s) 151
BssMI GATC 1 cut(s) 192
BstDEI CTNAG 4 cut(s) 21, 72, 126, 140
BstHHI GCGC 1 cut(s) 78
BstKTI GATC 1 cut(s) 195
BstMBI GATC 1 cut(s) 192
BsuI GTATCC 1 cut(s) 37
BsuRI GGCC 2 cut(s) 5, 181
CfoI GCGC 1 cut(s) 78
CviAII CATG 1 cut(s) 42
CviJI RGCY 6 cut(s) 5, 20, 68, 88, 136, 181
CviKI_1 RGCY 6 cut(s) 5, 20, 68, 88, 136, 181
DdeI CTNAG 4 cut(s) 21, 72, 126, 140
DpnI GATC 1 cut(s) 194
DpnII GATC 1 cut(s) 192
EaeI YGGCCR 1 cut(s) 179
FaeI CATG 1 cut(s) 45
FaiI YATR 5 cut(s) 43, 62, 83, 91, 204
FatI CATG 1 cut(s) 41
FbaI TGATCA 1 cut(s) 192
GlaI GCGC 1 cut(s) 77
HaeIII GGCC 2 cut(s) 5, 181
HhaI GCGC 1 cut(s) 78
Hin1II CATG 1 cut(s) 45
Hin6I GCGC 1 cut(s) 76
HinP1I GCGC 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 134
Hpy188III TCNNGA 2 cut(s) 13, 95
HpyAV CCTTC 1 cut(s) 10
HpyF3I CTNAG 4 cut(s) 21, 72, 126, 140
Hsp92II CATG 1 cut(s) 45
HspAI GCGC 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 1 cut(s) 192
LpnPI CCDG 3 cut(s) 8, 22, 203
MalI GATC 1 cut(s) 194
MboI GATC 1 cut(s) 192
MlsI TGGCCA 1 cut(s) 181
MluNI TGGCCA 1 cut(s) 181
MnlI CCTC 1 cut(s) 144
Mox20I TGGCCA 1 cut(s) 181
MscI TGGCCA 1 cut(s) 181
MseI TTAA 1 cut(s) 173
Msp20I TGGCCA 1 cut(s) 181
Mva1269I GAATGC 1 cut(s) 104
NdeII GATC 1 cut(s) 192
NlaIII CATG 1 cut(s) 45
PctI GAATGC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 173
Sau3AI GATC 1 cut(s) 192
SetI ASST 6 cut(s) 27, 41, 70, 138, 173, 192
SgeI CNNG 8 cut(s) 25, 35, 49, 54, 65, 107, 172, 202
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.