RchiOBHm_Chr1g0336681

SEC12-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
28391527 .. 28392519
993 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56462

Sequence Viewer

Length: 291 bp
ATGAACAAGCAACATCAATCCTTAAATAGAAGTATGGAACTAAATCCAACTTTCATTTGCAACACTGATAAGGTTGTGCTCACCACCTCTAGTGAATGGGGAGCTGTGGTGACCAAATTAAATGTTCCAGCAGATTGGAAAGAATGGCAGATCTATCTGTTGCTTTTAGGGCTGTTTTTGGCTTCTGCTGTTGCATTTTATATCTTCTTTGAGAAGTCTGATAATTTTTGGAACTTTCCTAGCCTCTTGGAAAAAATCAACCAGCAAGACCTGAATTCGGGGCATTTTTGA

Protein Analysis

96

Amino Acids

11.14

Weight (kDa)

5.51

Isoelectric Point (pI)

29.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 274
AfiI CCNNNNNNNGG 1 cut(s) 277
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw21I GWGCWC 1 cut(s) 81
ApoI RAATTY 1 cut(s) 274
AsuHPI GGTGA 2 cut(s) 73, 121
Bbv12I GWGCWC 1 cut(s) 81
BfaI CTAG 2 cut(s) 90, 240
BglII AGATCT 1 cut(s) 150
BsaXI ACNNNNNCTCC 2 cut(s) 93, 123
Bsc4I CCNNNNNNNGG 1 cut(s) 277
BseLI CCNNNNNNNGG 1 cut(s) 277
BsiHKAI GWGCWC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 277
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 150
BssMI GATC 1 cut(s) 150
BstEII GGTNACC 1 cut(s) 109
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstPI GGTNACC 1 cut(s) 109
BstX2I RGATCY 1 cut(s) 150
BstXI CCANNNNNNTGG 1 cut(s) 135
BstYI RGATCY 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 63
CviJI RGCY 4 cut(s) 104, 172, 182, 243
CviKI_1 RGCY 4 cut(s) 104, 172, 182, 243
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eco91I GGTNACC 1 cut(s) 109
EcoO65I GGTNACC 1 cut(s) 109
EcoRI GAATTC 1 cut(s) 274
FaiI YATR 2 cut(s) 35, 201
FspBI CTAG 2 cut(s) 90, 240
HphI GGTGA 2 cut(s) 73, 121
Hpy188I TCNGA 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 60, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
Kzo9I GATC 1 cut(s) 150
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 3 cut(s) 141, 275, 284
MaeI CTAG 2 cut(s) 90, 240
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 1 cut(s) 196
MflI RGATCY 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 3 cut(s) 116, 223, 274
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 2 cut(s) 97, 254
MseI TTAA 2 cut(s) 23, 119
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeII GATC 1 cut(s) 150
NmuCI GTSAC 1 cut(s) 109
PspEI GGTNACC 1 cut(s) 109
PsuI RGATCY 1 cut(s) 150
SaqAI TTAA 2 cut(s) 23, 119
Sau3AI GATC 1 cut(s) 150
SduI GDGCHC 1 cut(s) 81
SetI ASST 4 cut(s) 75, 89, 106, 273
SgeI CNNG 8 cut(s) 19, 102, 140, 252, 259, 274, 278, 283
Sse9I AATT 3 cut(s) 116, 223, 274
SspMI CTAG 2 cut(s) 90, 240
TasI AATT 3 cut(s) 116, 223, 274
Tru1I TTAA 2 cut(s) 23, 119
Tru9I TTAA 2 cut(s) 23, 119
TscAI CASTG 1 cut(s) 70
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 17, 43
TspRI CASTG 1 cut(s) 70
XapI RAATTY 1 cut(s) 274
XspI CTAG 2 cut(s) 90, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.