Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042619.1

Orthogroup ID

OG0010850

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 437

Gene Structure 437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042619.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 242 bp

atgatttttgttttcagattgtttgagttatatgggccagaatcaaatgccaagctgttggcaagagaatcagctcctttgcaaggaattggtccacagaagtgtctagcttttagtgtcgatggatctaagttggctactggcggtttggatgggcatatgagaattctggagtggccaagcctgtccataattttagatgaacctaaggcgcataaatctgtccgtgatatggatttcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002790 GO:0003400 GO:0003674 GO:0005085 GO:0005090 GO:0005096 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0005886 GO:0006810 GO:0006811 GO:0006817 GO:0006820 GO:0006888 GO:0006950 GO:0007154 GO:0008047 GO:0008104 GO:0008150 GO:0009267 GO:0009306 GO:0009605 GO:0009987 GO:0009991 GO:0012505 GO:0015031 GO:0015698 GO:0015833 GO:0016020 GO:0016021 GO:0016036 GO:0016192 GO:0019899 GO:0030176 GO:0030234 GO:0030695 GO:0031224 GO:0031227 GO:0031667 GO:0031668 GO:0031669 GO:0031984 GO:0032386 GO:0032879 GO:0032940 GO:0033036 GO:0033043 GO:0033554 GO:0042175 GO:0042594 GO:0042886 GO:0043085 GO:0043087 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043254 GO:0043547 GO:0044087 GO:0044093 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0046903 GO:0046907 GO:0048193 GO:0048209 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051020 GO:0051049 GO:0051128 GO:0051179 GO:0051234 GO:0051336 GO:0051345 GO:0051641 GO:0051649 GO:0051716 GO:0060341 GO:0060589 GO:0060627 GO:0060628 GO:0065007 GO:0065009 GO:0071496 GO:0071702 GO:0071705 GO:0071944 GO:0090113 GO:0098772 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko04141 map04141

Pfam Domains

Protein Families

WD40

Protein Analysis

80

Amino Acids

8.86

Weight (kDa)

6.05

Isoelectric Point (pI)

30.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010850)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G52190
fragaria_vesca	FvH4_7g06890 FvH4_7g06890
malus_domestica	MD02G1241000.v1.1 MD07G1075600.v1.1
prunus_persica	Prupe.2G096500_v2.0.a1
pyrus_communis	pycom02g20620 pycom07g05960
rosa_chinensis	RchiOBHm_Chr1g0336681 RchiOBHm_Chr1g0336701 RchiOBHm_Chr1g0336731
rosa_laevigata	RLG00000029338
rosa_multiflora	Rmu_sc0000907.1_g000011 Rmu_sc0011778.1_g000011 Rmu_sc0042619.1_g000001
rosa_roxburghii	Rroxscaffold_4G00315360
rosa_rugosa	Rorug01G0127500
rosa_samantha	Rh1CG140000 Rh1DG155600
rosa_wichuraiana	Rw1G011990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	144
AclWI	GGATC	1 cut(s)	133
AcoI	YGGCCR	1 cut(s)	176
AcsI	RAATTY	1 cut(s)	165
AfiI	CCNNNNNNNGG	2 cut(s)	83, 232
AleI	CACNNNNGTG	1 cut(s)	100
AluBI	AGCT	3 cut(s)	55, 74, 110
AluI	AGCT	3 cut(s)	55, 74, 110
AlwI	GGATC	1 cut(s)	133
AoxI	GGCC	2 cut(s)	35, 176
ApoI	RAATTY	1 cut(s)	165
AspLEI	GCGC	1 cut(s)	214
AspS9I	GGNCC	2 cut(s)	35, 92
AvaII	GGWCC	1 cut(s)	92
AxyI	CCTNAGG	1 cut(s)	207
BalI	TGGCCA	1 cut(s)	178
BccI	CCATC	2 cut(s)	116, 146
BfaI	CTAG	1 cut(s)	107
Bme18I	GGWCC	1 cut(s)	92
BmgT120I	GGNCC	2 cut(s)	35, 92
BpmI	CTGGAG	1 cut(s)	191
Bsc4I	CCNNNNNNNGG	2 cut(s)	83, 232
Bse1I	ACTGG	1 cut(s)	145
Bse21I	CCTNAGG	1 cut(s)	207
BseGI	GGATG	1 cut(s)	157
BseLI	CCNNNNNNNGG	2 cut(s)	83, 232
BseNI	ACTGG	1 cut(s)	145
BshFI	GGCC	2 cut(s)	37, 178
BslI	CCNNNNNNNGG	2 cut(s)	83, 232
BsnI	GGCC	2 cut(s)	37, 178
Bsp143I	GATC	1 cut(s)	125
BspACI	CCGC	1 cut(s)	144
BspANI	GGCC	2 cut(s)	37, 178
BspPI	GGATC	1 cut(s)	133
BsrI	ACTGG	1 cut(s)	145
BssMI	GATC	1 cut(s)	125
BstDEI	CTNAG	2 cut(s)	129, 207
BstENI	CCTNNNNNAGG	1 cut(s)	81
BstF5I	GGATG	1 cut(s)	157
BstHHI	GCGC	1 cut(s)	214
BstKTI	GATC	1 cut(s)	128
BstMBI	GATC	1 cut(s)	125
BstX2I	RGATCY	1 cut(s)	125
BstXI	CCANNNNNNTGG	1 cut(s)	58
BstYI	RGATCY	1 cut(s)	125
Bsu36I	CCTNAGG	1 cut(s)	207
BsuRI	GGCC	2 cut(s)	37, 178
BtsCI	GGATG	1 cut(s)	157
CfoI	GCGC	1 cut(s)	214
Cfr13I	GGNCC	2 cut(s)	35, 92
CviJI	RGCY	7 cut(s)	37, 55, 74, 110, 137, 178, 183
CviKI_1	RGCY	7 cut(s)	37, 55, 74, 110, 137, 178, 183
DdeI	CTNAG	2 cut(s)	129, 207
DpnI	GATC	1 cut(s)	127
DpnII	GATC	1 cut(s)	125
EaeI	YGGCCR	1 cut(s)	176
Eco47I	GGWCC	1 cut(s)	92
Eco81I	CCTNAGG	1 cut(s)	207
EcoNI	CCTNNNNNAGG	1 cut(s)	81
EcoRI	GAATTC	1 cut(s)	165
FaiI	YATR	7 cut(s)	31, 33, 159, 161, 191, 216, 233
FauNDI	CATATG	1 cut(s)	159
FokI	GGATG	1 cut(s)	164
FspBI	CTAG	1 cut(s)	107
GlaI	GCGC	1 cut(s)	213
GsuI	CTGGAG	1 cut(s)	191
HaeIII	GGCC	2 cut(s)	37, 178
HhaI	GCGC	1 cut(s)	214
Hin6I	GCGC	1 cut(s)	212
HinP1I	GCGC	1 cut(s)	212
HinfI	GANTC	2 cut(s)	41, 68
Hpy166II	GTNNAC	1 cut(s)	95
Hpy188I	TCNGA	1 cut(s)	17
Hpy188III	TCNNGA	1 cut(s)	170
Hpy8I	GTNNAC	1 cut(s)	95
HpyCH4V	TGCA	1 cut(s)	82
HpyF3I	CTNAG	2 cut(s)	129, 207
HspAI	GCGC	1 cut(s)	212
Kzo9I	GATC	1 cut(s)	125
LmnI	GCTCC	1 cut(s)	79
LpnPI	CCDG	4 cut(s)	51, 126, 155, 197
MaeI	CTAG	1 cut(s)	107
MalI	GATC	1 cut(s)	127
MboI	GATC	1 cut(s)	125
MflI	RGATCY	1 cut(s)	125
MlsI	TGGCCA	1 cut(s)	178
MluCI	AATT	3 cut(s)	87, 165, 192
MluNI	TGGCCA	1 cut(s)	178
Mox20I	TGGCCA	1 cut(s)	178
MscI	TGGCCA	1 cut(s)	178
MslI	CAYNNNNRTG	1 cut(s)	100
Msp20I	TGGCCA	1 cut(s)	178
NdeI	CATATG	1 cut(s)	159
NdeII	GATC	1 cut(s)	125
OliI	CACNNNNGTG	1 cut(s)	100
PfeI	GAWTC	2 cut(s)	41, 68
PspPI	GGNCC	2 cut(s)	35, 92
PsuI	RGATCY	1 cut(s)	125
RseI	CAYNNNNRTG	1 cut(s)	100
Sau3AI	GATC	1 cut(s)	125
Sau96I	GGNCC	2 cut(s)	35, 92
SetI	ASST	4 cut(s)	57, 76, 112, 208
SgeI	CNNG	9 cut(s)	50, 64, 75, 95, 119, 153, 182, 192, 196
SinI	GGWCC	1 cut(s)	92
SmiMI	CAYNNNNRTG	1 cut(s)	100
Sse9I	AATT	3 cut(s)	87, 165, 192
SsiI	CCGC	1 cut(s)	144
SspMI	CTAG	1 cut(s)	107
TaqI	TCGA	1 cut(s)	120
TasI	AATT	3 cut(s)	87, 165, 192
TfiI	GAWTC	2 cut(s)	41, 68
TspDTI	ATGAA	1 cut(s)	216
TspGWI	ACGGA	1 cut(s)	215
VpaK11BI	GGWCC	1 cut(s)	92
XagI	CCTNNNNNAGG	1 cut(s)	81
XapI	RAATTY	1 cut(s)	165
XspI	CTAG	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.