RchiOBHm_Chr2g0105621

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
16917073 .. 16920405
3333 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47982

Sequence Viewer

Length: 162 bp
ATGTTCGCCGTCATCAATAGCGTGACCAAAGCCGCAGACCGCGACGACGCCGTTAGTCACCTCAATTCCTCGTCTCCAGGTTGCAGGGGACCAAACGAAAGCTGGAATAGGGGAGCAAGACTGAGTACTTACAGGCGCAGAGGTTCTCCTTGTACGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.75

Weight (kDa)

10.07

Isoelectric Point (pI)

51.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 42
AciI CCGC 2 cut(s) 33, 40
AcyI GRCGYC 1 cut(s) 48
AfaI GTAC 2 cut(s) 127, 154
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
Alw26I GTCTC 1 cut(s) 78
AspLEI GCGC 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 50
AvaII GGWCC 1 cut(s) 89
BceAI ACGGC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 78
BcoDI GTCTC 1 cut(s) 78
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
BmcAI AGTACT 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 78
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 78
BpmI CTGGAG 1 cut(s) 60
BsaHI GRCGYC 1 cut(s) 48
BseBI CCWGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 113
Bsh1236I CGCG 1 cut(s) 42
BslFI GGGAC 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 78
BsmBI CGTCTC 1 cut(s) 78
BsmFI GGGAC 1 cut(s) 102
BspACI CCGC 2 cut(s) 33, 40
BspCNI CTCAG 1 cut(s) 114
BspFNI CGCG 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 90
BssNI GRCGYC 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 78
BstACI GRCGYC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 122
BstFNI CGCG 1 cut(s) 42
BstHHI GCGC 1 cut(s) 138
BstMAI GTCTC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstUI CGCG 1 cut(s) 42
CfoI GCGC 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 89
CseI GACGC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 126, 153
CviJI RGCY 2 cut(s) 32, 102
CviKI_1 RGCY 2 cut(s) 32, 102
CviQI GTAC 2 cut(s) 126, 153
DdeI CTNAG 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 76
Esp3I CGTCTC 1 cut(s) 78
FaiI YATR 1 cut(s) 160
FaqI GGGAC 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
GlaI GCGC 1 cut(s) 137
GluI GCNGC 1 cut(s) 33
GsuI CTGGAG 1 cut(s) 60
HgaI GACGC 1 cut(s) 56
HhaI GCGC 1 cut(s) 138
Hin1I GRCGYC 1 cut(s) 48
Hin6I GCGC 1 cut(s) 136
HinP1I GCGC 1 cut(s) 136
HphI GGTGA 1 cut(s) 50
Hpy99I CGWCG 2 cut(s) 47, 50
HpyCH4V TGCA 1 cut(s) 84
HpyF3I CTNAG 1 cut(s) 122
Hsp92I GRCGYC 1 cut(s) 48
HspAI GCGC 1 cut(s) 136
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 5 cut(s) 63, 70, 88, 90, 118
MaeIII GTNAC 2 cut(s) 22, 56
MluCI AATT 1 cut(s) 64
MnlI CCTC 3 cut(s) 71, 79, 134
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
MvnI CGCG 1 cut(s) 42
NlaIV GGNNCC 1 cut(s) 90
NmuCI GTSAC 2 cut(s) 22, 56
PkrI GCNGC 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 2 cut(s) 127, 154
RsaNI GTAC 2 cut(s) 126, 153
SatI GCNGC 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 89
ScaI AGTACT 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 78
SetI ASST 4 cut(s) 63, 82, 104, 145
SgeI CNNG 9 cut(s) 34, 53, 82, 89, 90, 97, 115, 129, 145
SinI GGWCC 1 cut(s) 89
Sse9I AATT 1 cut(s) 64
SsiI CCGC 2 cut(s) 33, 40
StyD4I CCNGG 1 cut(s) 76
TasI AATT 1 cut(s) 64
TatI WGTACW 1 cut(s) 125
TauI GCSGC 1 cut(s) 35
TseFI GTSAC 2 cut(s) 22, 56
Tsp45I GTSAC 2 cut(s) 22, 56
VpaK11BI GGWCC 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 99
ZrmI AGTACT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.