RchiOBHm_Chr2g0117601

Belongs to the nucleosome assembly protein (NAP) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0016304
Physical Location & Seq
Reverse (-)
29800189 .. 29802663
2475 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49050

Sequence Viewer

Length: 219 bp
ATGGTGGCTGCGGTGAGTCCACCTTGGTGGTCGGAGATCGATGACGGAGGAAAGAGTCTTCCAGATCCAGTTTCTCTCTCCTCCATCTCTCTCTATGGAAAGGAGACCTTGGTTGGATTGCATTCTAACAAATTGGAGTCACCCGAGCTGAAGACCCGCATTGAGGCTTTAACAGAAATACAGGGCCAACTCAAGGTCCTGGAAACAAAATCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAP

Protein Analysis

72

Amino Acids

7.85

Weight (kDa)

4.94

Isoelectric Point (pI)

48.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 11, 157
AclWI GGATC 1 cut(s) 59
AcuI CTGAAG 1 cut(s) 170
AfiI CCNNNNNNNGG 2 cut(s) 163, 193
AjnI CCWGG 1 cut(s) 198
AleI CACNNNNGTG 1 cut(s) 25
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 1 cut(s) 59
Ama87I CYCGRG 1 cut(s) 143
AoxI GGCC 1 cut(s) 184
ApeKI GCWGC 1 cut(s) 8
AspS9I GGNCC 2 cut(s) 184, 196
AsuHPI GGTGA 2 cut(s) 25, 132
AvaI CYCGRG 1 cut(s) 143
AvaII GGWCC 1 cut(s) 196
BbsI GAAGAC 2 cut(s) 50, 158
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 200
BcoDI GTCTC 1 cut(s) 98
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 200
Bme18I GGWCC 1 cut(s) 196
BmeT110I CYCGRG 1 cut(s) 143
BmgT120I GGNCC 2 cut(s) 184, 196
BmrFI CCNGG 1 cut(s) 200
BpiI GAAGAC 2 cut(s) 50, 158
BpuEI CTTGAG 1 cut(s) 176
Bsa29I ATCGAT 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 23, 108
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 193
Bse1I ACTGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 200
BseCI ATCGAT 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 23, 108
BseLI CCNNNNNNNGG 2 cut(s) 163, 193
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 70
BshFI GGCC 1 cut(s) 186
BshVI ATCGAT 1 cut(s) 39
BsiHKCI CYCGRG 1 cut(s) 143
BslI CCNNNNNNNGG 2 cut(s) 163, 193
BsmAI GTCTC 1 cut(s) 98
BsmI GAATGC 1 cut(s) 121
BsnI GGCC 1 cut(s) 186
Bso31I GGTCTC 1 cut(s) 98
BsoBI CYCGRG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 36, 64
BspACI CCGC 2 cut(s) 11, 157
BspANI GGCC 1 cut(s) 186
BspDI ATCGAT 1 cut(s) 39
BspPI GGATC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 2 cut(s) 23, 108
BssMI GATC 2 cut(s) 36, 64
BssT1I CCWWGG 2 cut(s) 23, 108
Bst2UI CCWGG 1 cut(s) 200
BstKTI GATC 2 cut(s) 39, 67
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 36, 64
BstNI CCWGG 1 cut(s) 200
BstSCI CCNGG 1 cut(s) 198
BstV2I GAAGAC 2 cut(s) 50, 158
BstX2I RGATCY 1 cut(s) 64
BstXI CCANNNNNNTGG 1 cut(s) 27
BstYI RGATCY 1 cut(s) 64
Bsu15I ATCGAT 1 cut(s) 39
BsuRI GGCC 1 cut(s) 186
BsuTUI ATCGAT 1 cut(s) 39
Cfr13I GGNCC 2 cut(s) 184, 196
ClaI ATCGAT 1 cut(s) 39
CviJI RGCY 4 cut(s) 8, 148, 167, 186
CviKI_1 RGCY 4 cut(s) 8, 148, 167, 186
DpnI GATC 2 cut(s) 38, 66
DpnII GATC 2 cut(s) 36, 64
Eco130I CCWWGG 2 cut(s) 23, 108
Eco31I GGTCTC 1 cut(s) 98
Eco47I GGWCC 1 cut(s) 196
Eco57I CTGAAG 1 cut(s) 170
Eco88I CYCGRG 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 198
EcoT14I CCWWGG 2 cut(s) 23, 108
ErhI CCWWGG 2 cut(s) 23, 108
FaiI YATR 1 cut(s) 96
FalI AAGNNNNNCTT 2 cut(s) 92, 124
FauI CCCGC 1 cut(s) 164
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 1 cut(s) 186
HinfI GANTC 3 cut(s) 16, 55, 137
HphI GGTGA 2 cut(s) 25, 132
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 36, 64
LpnPI CCDG 5 cut(s) 75, 81, 167, 185, 212
MaeIII GTNAC 1 cut(s) 138
MalI GATC 2 cut(s) 38, 66
MboI GATC 2 cut(s) 36, 64
MboII GAAGA 2 cut(s) 50, 163
MflI RGATCY 1 cut(s) 64
MluCI AATT 1 cut(s) 131
MlyI GAGTC 3 cut(s) 25, 64, 146
MmeI TCCRAC 2 cut(s) 12, 94
MnlI CCTC 3 cut(s) 41, 91, 157
MseI TTAA 1 cut(s) 170
MslI CAYNNNNRTG 1 cut(s) 25
MspR9I CCNGG 1 cut(s) 200
Mva1269I GAATGC 1 cut(s) 121
MvaI CCWGG 1 cut(s) 200
NdeII GATC 2 cut(s) 36, 64
NmuCI GTSAC 1 cut(s) 138
OliI CACNNNNGTG 1 cut(s) 25
PctI GAATGC 1 cut(s) 121
PfoI TCCNGGA 1 cut(s) 198
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 3 cut(s) 24, 63, 145
PpsI GAGTC 3 cut(s) 24, 63, 145
PpuMI RGGWCCY 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 198
PspGI CCWGG 1 cut(s) 198
PspPI GGNCC 2 cut(s) 184, 196
PspPPI RGGWCCY 1 cut(s) 196
PsuI RGATCY 1 cut(s) 64
RseI CAYNNNNRTG 1 cut(s) 25
SaqAI TTAA 1 cut(s) 170
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 36, 64
Sau96I GGNCC 2 cut(s) 184, 196
SchI GAGTC 3 cut(s) 25, 64, 146
ScrFI CCNGG 1 cut(s) 200
SetI ASST 4 cut(s) 25, 110, 150, 198
SinI GGWCC 1 cut(s) 196
SmiMI CAYNNNNRTG 1 cut(s) 25
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 1 cut(s) 131
SsiI CCGC 2 cut(s) 11, 157
StyD4I CCNGG 1 cut(s) 198
StyI CCWWGG 2 cut(s) 23, 108
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 131
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TseFI GTSAC 1 cut(s) 138
TseI GCWGC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 60
VpaK11BI GGWCC 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.