RchiOBHm_Chr2g0131431

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
47635584 .. 47639205
3622 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50278

Sequence Viewer

Length: 189 bp
ATGGTGGCTGCGGTGAGTCCACCTTGGTGGTCGGAGATCGATGACGGAGGAAAGAGTCTTCCAGATCCAGTTTCTCTCTCCTCCATCTCTCTCTATGGAAAGGAGACCTTGGTTGGATTGCATTCTAACAAATTGGAATCACCCGAGCTGAAGACCCATATTGAGGCTTTGACAGAAATACGGGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.69

Weight (kDa)

4.86

Isoelectric Point (pI)

63.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AclWI GGATC 1 cut(s) 59
AcuI CTGAAG 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 163
AleI CACNNNNGTG 1 cut(s) 25
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 1 cut(s) 59
Ama87I CYCGRG 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 8
AsuHPI GGTGA 2 cut(s) 25, 132
AvaI CYCGRG 1 cut(s) 143
BbsI GAAGAC 2 cut(s) 50, 158
BccI CCATC 1 cut(s) 92
BcoDI GTCTC 1 cut(s) 98
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmeT110I CYCGRG 1 cut(s) 143
BpiI GAAGAC 2 cut(s) 50, 158
Bsa29I ATCGAT 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 23, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 163
Bse1I ACTGG 1 cut(s) 68
BseCI ATCGAT 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 23, 108
BseLI CCNNNNNNNGG 1 cut(s) 163
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 70
BshVI ATCGAT 1 cut(s) 39
BsiHKCI CYCGRG 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 163
BsmAI GTCTC 1 cut(s) 98
BsmI GAATGC 1 cut(s) 121
Bso31I GGTCTC 1 cut(s) 98
BsoBI CYCGRG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 36, 64
BspACI CCGC 1 cut(s) 11
BspDI ATCGAT 1 cut(s) 39
BspPI GGATC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 2 cut(s) 23, 108
BssMI GATC 2 cut(s) 36, 64
BssT1I CCWWGG 2 cut(s) 23, 108
BstKTI GATC 2 cut(s) 39, 67
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 36, 64
BstV2I GAAGAC 2 cut(s) 50, 158
BstX2I RGATCY 1 cut(s) 64
BstXI CCANNNNNNTGG 1 cut(s) 27
BstYI RGATCY 1 cut(s) 64
Bsu15I ATCGAT 1 cut(s) 39
BsuTUI ATCGAT 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 39
CviJI RGCY 4 cut(s) 8, 148, 167, 186
CviKI_1 RGCY 4 cut(s) 8, 148, 167, 186
DpnI GATC 2 cut(s) 38, 66
DpnII GATC 2 cut(s) 36, 64
Eco130I CCWWGG 2 cut(s) 23, 108
Eco31I GGTCTC 1 cut(s) 98
Eco57I CTGAAG 1 cut(s) 170
Eco88I CYCGRG 1 cut(s) 143
EcoT14I CCWWGG 2 cut(s) 23, 108
ErhI CCWWGG 2 cut(s) 23, 108
FaiI YATR 2 cut(s) 96, 159
FalI AAGNNNNNCTT 2 cut(s) 92, 124
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
GluI GCNGC 1 cut(s) 9
HinfI GANTC 3 cut(s) 16, 55, 137
HphI GGTGA 2 cut(s) 25, 132
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 36, 64
LpnPI CCDG 2 cut(s) 75, 81
MalI GATC 2 cut(s) 38, 66
MboI GATC 2 cut(s) 36, 64
MboII GAAGA 2 cut(s) 50, 163
MflI RGATCY 1 cut(s) 64
MluCI AATT 1 cut(s) 131
MlyI GAGTC 2 cut(s) 25, 64
MmeI TCCRAC 2 cut(s) 12, 94
MnlI CCTC 3 cut(s) 41, 91, 157
MslI CAYNNNNRTG 1 cut(s) 25
Mva1269I GAATGC 1 cut(s) 121
NdeII GATC 2 cut(s) 36, 64
OliI CACNNNNGTG 1 cut(s) 25
PctI GAATGC 1 cut(s) 121
PfeI GAWTC 1 cut(s) 137
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 2 cut(s) 24, 63
PpsI GAGTC 2 cut(s) 24, 63
PsuI RGATCY 1 cut(s) 64
RseI CAYNNNNRTG 1 cut(s) 25
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 36, 64
SchI GAGTC 2 cut(s) 25, 64
SetI ASST 3 cut(s) 25, 110, 150
SgeI CNNG 6 cut(s) 36, 74, 80, 121, 155, 157
SmiMI CAYNNNNRTG 1 cut(s) 25
Sse9I AATT 1 cut(s) 131
SsiI CCGC 1 cut(s) 11
StyI CCWWGG 2 cut(s) 23, 108
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 131
TfiI GAWTC 1 cut(s) 137
TseI GCWGC 1 cut(s) 8
TspGWI ACGGA 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.