RchiOBHm_Chr2g0126381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
40760749 .. 40761324
576 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49837

Sequence Viewer

Length: 228 bp
ATGGTGTCTTTCTTTTGTGTGCATATGCTTCAGACCTTGGTTGGATTGCATTCTAACAAATTGGAATCACCCGAGCTGAAGACCCATATTGAGGCTTTGACAGAAATACGGCACTACTGGCATTGTGTTCATCCATACAGCTTAGGAGTACCCATTCCCATTGTTCTTTTTACAGGGCTAACTCAAGGACCTGGAAACAAAATCTTTTTGAGGAGAGAGCTGCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.63

Weight (kDa)

7.91

Isoelectric Point (pI)

59.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 14, 98
AfaI GTAC 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 91
AjnI CCWGG 1 cut(s) 190
AluBI AGCT 3 cut(s) 76, 141, 220
AluI AGCT 3 cut(s) 76, 141, 220
Ama87I CYCGRG 1 cut(s) 71
ApeKI GCWGC 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 60
AvaI CYCGRG 1 cut(s) 71
AvaII GGWCC 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 207
BceAI ACGGC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 192
BisI GCNGC 1 cut(s) 221
BlsI GCNGC 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 192
Bme18I GGWCC 1 cut(s) 188
BmeT110I CYCGRG 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 192
BpiI GAAGAC 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 122
BseBI CCWGG 1 cut(s) 192
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 226
BseXI GCAGC 1 cut(s) 207
BsgI GTGCAG 1 cut(s) 206
BsiHKCI CYCGRG 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 91
BsmI GAATGC 1 cut(s) 49
BsoBI CYCGRG 1 cut(s) 71
BsrI ACTGG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 1 cut(s) 190
BstV1I GCAGC 1 cut(s) 207
BstV2I GAAGAC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 223
Cfr13I GGNCC 1 cut(s) 188
Csp6I GTAC 1 cut(s) 149
CviJI RGCY 5 cut(s) 76, 95, 141, 178, 220
CviKI_1 RGCY 5 cut(s) 76, 95, 141, 178, 220
CviQI GTAC 1 cut(s) 149
DdeI CTNAG 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 188
Eco57I CTGAAG 2 cut(s) 14, 98
Eco88I CYCGRG 1 cut(s) 71
EcoO109I RGGNCCY 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaiI YATR 4 cut(s) 24, 26, 87, 136
FauNDI CATATG 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 221
FokI GGATG 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 221
GluI GCNGC 1 cut(s) 221
HinfI GANTC 1 cut(s) 65
HphI GGTGA 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 33
HpyCH4V TGCA 3 cut(s) 22, 49, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpyF3I CTNAG 1 cut(s) 142
LpnPI CCDG 4 cut(s) 103, 159, 177, 204
Lsp1109I GCAGC 1 cut(s) 207
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 2 cut(s) 85, 204
MspR9I CCNGG 1 cut(s) 192
Mva1269I GAATGC 1 cut(s) 49
MvaI CCWGG 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 118
NdeI CATATG 1 cut(s) 24
PctI GAATGC 1 cut(s) 49
PfeI GAWTC 1 cut(s) 65
PkrI GCNGC 1 cut(s) 222
PpuMI RGGWCCY 1 cut(s) 188
Psp5II RGGWCCY 1 cut(s) 188
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
PspPI GGNCC 1 cut(s) 188
PspPPI RGGWCCY 1 cut(s) 188
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
SatI GCNGC 1 cut(s) 221
Sau96I GGNCC 1 cut(s) 188
ScrFI CCNGG 1 cut(s) 192
SetI ASST 5 cut(s) 38, 78, 143, 193, 222
SgeI CNNG 8 cut(s) 49, 83, 85, 130, 186, 197, 203, 204
SinI GGWCC 1 cut(s) 188
SmlI CTYRAG 1 cut(s) 183
SmoI CTYRAG 1 cut(s) 183
Sse9I AATT 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 190
StyI CCWWGG 1 cut(s) 36
TasI AATT 1 cut(s) 59
TfiI GAWTC 1 cut(s) 65
TseI GCWGC 1 cut(s) 220
TspDTI ATGAA 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.