RchiOBHm_Chr2g0155061

K( ) efflux antiporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
72085487 .. 72086430
944 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52398

Sequence Viewer

Length: 264 bp
ATGCTGATTCATGTTCAGTTTCTCTGGAATCATGTTGATATATTTCTCGCGTCTGTCATCTTAGTTATCATCATAAAAACAATTATTATAACCATGGTTGTCAAGGGATTTGGATACAACAACAAAACATCATTCCTAGTTGGAATATCTCTAGCACAGATAGGCGAATTTGCTTTTGTTCTTTTAAGTCGTGCCTCTAATCTCCATCTAGTCGAGGGGAAATTATATCTGCTGCTGCTTGGAACCACTGCACTTAGTCTGTGA
Functional Annotation

Protein Analysis

87

Amino Acids

9.63

Weight (kDa)

9.3

Isoelectric Point (pI)

10.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Na_H_Exchanger PF00999 2 - 87 1.2e-12 Sodium/hydrogen exchanger, transmembrane
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 89
AccII CGCG 1 cut(s) 50
AcsI RAATTY 1 cut(s) 167
ApeKI GCWGC 2 cut(s) 232, 235
ApoI RAATTY 1 cut(s) 167
BbvI GCAGC 2 cut(s) 219, 222
BccI CCATC 1 cut(s) 213
BciVI GTATCC 1 cut(s) 107
BfaI CTAG 3 cut(s) 137, 152, 209
BfuI GTATCC 1 cut(s) 107
BisI GCNGC 2 cut(s) 233, 236
BlsI GCNGC 2 cut(s) 234, 237
BmiI GGNNCC 1 cut(s) 244
BsaJI CCNNGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 93
BseXI GCAGC 2 cut(s) 219, 222
BsgI GTGCAG 1 cut(s) 234
Bsh1236I CGCG 1 cut(s) 50
Bsp19I CCATGG 1 cut(s) 93
BspFNI CGCG 1 cut(s) 50
BspLI GGNNCC 1 cut(s) 244
BssECI CCNNGG 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 93
BstDEI CTNAG 2 cut(s) 61, 254
BstDSI CCRYGG 1 cut(s) 93
BstFNI CGCG 1 cut(s) 50
BstUI CGCG 1 cut(s) 50
BstV1I GCAGC 2 cut(s) 219, 222
BsuI GTATCC 1 cut(s) 107
BtgI CCRYGG 1 cut(s) 93
BtsI GCAGTG 1 cut(s) 246
BtsIMutI CAGTG 1 cut(s) 246
CseI GACGC 1 cut(s) 39
CviAII CATG 3 cut(s) 11, 32, 94
DdeI CTNAG 2 cut(s) 61, 254
Eco130I CCWWGG 1 cut(s) 93
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 3 cut(s) 14, 35, 97
FaiI YATR 7 cut(s) 12, 33, 41, 74, 89, 95, 226
FatI CATG 3 cut(s) 10, 31, 93
Fnu4HI GCNGC 2 cut(s) 233, 236
Fsp4HI GCNGC 2 cut(s) 233, 236
FspBI CTAG 3 cut(s) 137, 152, 209
GluI GCNGC 2 cut(s) 233, 236
HgaI GACGC 1 cut(s) 39
Hin1II CATG 3 cut(s) 14, 35, 97
HinfI GANTC 2 cut(s) 7, 28
Hpy188III TCNNGA 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 251
HpyF3I CTNAG 2 cut(s) 61, 254
Hsp92II CATG 3 cut(s) 14, 35, 97
LpnPI CCDG 1 cut(s) 10
Lsp1109I GCAGC 2 cut(s) 219, 222
MaeI CTAG 3 cut(s) 137, 152, 209
MluCI AATT 3 cut(s) 81, 167, 221
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 2 cut(s) 205, 208
MseI TTAA 1 cut(s) 185
MvnI CGCG 1 cut(s) 50
NcoI CCATGG 1 cut(s) 93
NlaIII CATG 3 cut(s) 14, 35, 97
NlaIV GGNNCC 1 cut(s) 244
PfeI GAWTC 2 cut(s) 7, 28
PkrI GCNGC 2 cut(s) 234, 237
PsiI TTATAA 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 244
SaqAI TTAA 1 cut(s) 185
SatI GCNGC 2 cut(s) 233, 236
Sse9I AATT 3 cut(s) 81, 167, 221
SspMI CTAG 3 cut(s) 137, 152, 209
StyI CCWWGG 1 cut(s) 93
TaqI TCGA 1 cut(s) 213
TasI AATT 3 cut(s) 81, 167, 221
TfiI GAWTC 2 cut(s) 7, 28
Tru1I TTAA 1 cut(s) 185
Tru9I TTAA 1 cut(s) 185
TscAI CASTG 1 cut(s) 253
TseI GCWGC 2 cut(s) 232, 235
TspRI CASTG 1 cut(s) 253
XapI RAATTY 1 cut(s) 167
XspI CTAG 3 cut(s) 137, 152, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.