Rh3BG058800

K( ) efflux antiporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
4017603 .. 4018916
1314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG058800.1

Sequence Viewer

Length: 213 bp
ATGGTTGTCAAGGGATTCGGATACAACAACAAAACATCATTCCTAGTTGGAATATCTCTAGCACAGATAGGCGAATTTGCTTTTGTTCTTTTAAATCGTGCCTCTAATCTCCATCTAGTCGAGGAGAAATCATATCTGCTGCTGATTGGAACCACAACACTTAGTCTGTTCCAATACTGTGTAGGATGGAGACATGTTTTGGAGGATGCGTGA
Functional Annotation

Protein Analysis

70

Amino Acids

7.84

Weight (kDa)

6.7

Isoelectric Point (pI)

14.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Na_H_Exchanger PF00999 3 - 57 2e-07 Sodium/hydrogen exchanger, transmembrane
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 74
AflIII ACRYGT 1 cut(s) 193
Alw26I GTCTC 1 cut(s) 184
ApeKI GCWGC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 74
BbvI GCAGC 1 cut(s) 126
BccI CCATC 2 cut(s) 120, 180
BciVI GTATCC 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 184
BfaI CTAG 3 cut(s) 44, 59, 116
BfuI GTATCC 1 cut(s) 14
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 151
BmsI GCATC 1 cut(s) 196
BsaXI ACNNNNNCTCC 1 cut(s) 194
BseGI GGATG 2 cut(s) 191, 211
BseRI GAGGAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 179
BstDEI CTNAG 1 cut(s) 161
BstF5I GGATG 2 cut(s) 191, 211
BstMAI GTCTC 1 cut(s) 184
BstNSI RCATGY 1 cut(s) 197
BstV1I GCAGC 1 cut(s) 126
BsuI GTATCC 1 cut(s) 14
BtsCI GGATG 2 cut(s) 191, 211
CviAII CATG 1 cut(s) 194
DdeI CTNAG 1 cut(s) 161
DraI TTTAAA 1 cut(s) 93
FaeI CATG 1 cut(s) 197
FaiI YATR 2 cut(s) 133, 195
FatI CATG 1 cut(s) 193
Fnu4HI GCNGC 1 cut(s) 140
FokI GGATG 1 cut(s) 198
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 3 cut(s) 44, 59, 116
GluI GCNGC 1 cut(s) 140
Hin1II CATG 1 cut(s) 197
HinfI GANTC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 161
Hsp92II CATG 1 cut(s) 197
Lsp1109I GCAGC 1 cut(s) 126
LweI GCATC 1 cut(s) 196
MaeI CTAG 3 cut(s) 44, 59, 116
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 3 cut(s) 112, 115, 196
MseI TTAA 1 cut(s) 92
NlaIII CATG 1 cut(s) 197
NlaIV GGNNCC 1 cut(s) 151
NspI RCATGY 1 cut(s) 197
PciI ACATGT 1 cut(s) 193
PfeI GAWTC 1 cut(s) 15
PkrI GCNGC 1 cut(s) 141
PscI ACATGT 1 cut(s) 193
PspN4I GGNNCC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 92
SatI GCNGC 1 cut(s) 140
SfaNI GCATC 1 cut(s) 196
SgeI CNNG 7 cut(s) 22, 56, 71, 110, 128, 133, 206
Sse9I AATT 1 cut(s) 74
SspMI CTAG 3 cut(s) 44, 59, 116
TaaI ACNGT 1 cut(s) 179
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 74
TfiI GAWTC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TseI GCWGC 1 cut(s) 139
XapI RAATTY 1 cut(s) 74
XceI RCATGY 1 cut(s) 197
XspI CTAG 3 cut(s) 44, 59, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.