Rh3DG059400

K( ) efflux antiporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
4017603 .. 4018146
544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG059400.1

Sequence Viewer

Length: 219 bp
ATGGTTGTCAAGGGATTCGGATACAACAACAAAACATCATTCCTAGTTGGAATATCTCTAGCACAGATAGGCGAATTTGCTTTTGTTCTTTTAAATCGTGCCTCTAATCTCCATCTAGTCGAGGAGAAATCATATCTGCTGCTGATTGGAACCACAACACTTAGTCTGGTGACCACTCCTTTTCTATTCAAGCTAATCCCTATTAATGAGCTTTGGTAA
Functional Annotation

Protein Analysis

72

Amino Acids

8.05

Weight (kDa)

8.12

Isoelectric Point (pI)

11.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Na_H_Exchanger PF00999 3 - 64 7.7e-09 Sodium/hydrogen exchanger, transmembrane
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 74
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 2 cut(s) 193, 211
AluI AGCT 2 cut(s) 193, 211
ApeKI GCWGC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 74
AseI ATTAAT 1 cut(s) 204
AsuHPI GGTGA 1 cut(s) 181
BbvI GCAGC 1 cut(s) 126
BccI CCATC 1 cut(s) 120
BciVI GTATCC 1 cut(s) 14
BfaI CTAG 3 cut(s) 44, 59, 116
BfuI GTATCC 1 cut(s) 14
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 161
BstEII GGTNACC 1 cut(s) 169
BstPI GGTNACC 1 cut(s) 169
BstV1I GCAGC 1 cut(s) 126
BsuI GTATCC 1 cut(s) 14
CviJI RGCY 2 cut(s) 193, 211
CviKI_1 RGCY 2 cut(s) 193, 211
DdeI CTNAG 1 cut(s) 161
DraI TTTAAA 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 169
EcoO65I GGTNACC 1 cut(s) 169
FaiI YATR 1 cut(s) 133
Fnu4HI GCNGC 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 3 cut(s) 44, 59, 116
GluI GCNGC 1 cut(s) 140
HinfI GANTC 1 cut(s) 15
HphI GGTGA 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 161
LpnPI CCDG 1 cut(s) 152
Lsp1109I GCAGC 1 cut(s) 126
MaeI CTAG 3 cut(s) 44, 59, 116
MaeIII GTNAC 1 cut(s) 169
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 2 cut(s) 112, 115
MseI TTAA 2 cut(s) 92, 204
NlaIV GGNNCC 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 15
PkrI GCNGC 1 cut(s) 141
PshBI ATTAAT 1 cut(s) 204
PspEI GGTNACC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 151
SaqAI TTAA 2 cut(s) 92, 204
SatI GCNGC 1 cut(s) 140
SetI ASST 2 cut(s) 195, 213
SgeI CNNG 8 cut(s) 22, 56, 71, 110, 128, 133, 179, 202
Sse9I AATT 1 cut(s) 74
SspMI CTAG 3 cut(s) 44, 59, 116
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 74
TfiI GAWTC 1 cut(s) 15
Tru1I TTAA 2 cut(s) 92, 204
Tru9I TTAA 2 cut(s) 92, 204
TseFI GTSAC 1 cut(s) 169
TseI GCWGC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 169
VspI ATTAAT 1 cut(s) 204
XapI RAATTY 1 cut(s) 74
XspI CTAG 3 cut(s) 44, 59, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.