Rw5G016220

K( ) efflux antiporter

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
20328513 .. 20331819
3307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G016220.1

Sequence Viewer

Length: 330 bp
ATGAGATTGGCCAAAATATTGGGGCTGATGTTTCAGTGTGCAACATTACAGGTATGTTGTTATCACTTTTTCTCGTTGATATCAACAACTGATCTTGCTCAACATACACTAGAACAAGTTGGAATATCTCTAGCACAGATAGGCGAATTTGCTTTTGTTCTTTTAAGTCGTGCCTCTAATCTCCATCTAGTCGAGGGCAAATTATATCTGCTGCTGATTGGAAACACAACACTTAGTCTGGTGACCACTCCTTTTCTATTCAAGCTAATCCCTATTAATGAGCTTTGGCCACACGAGGATGGTTACTCTCGTTCTAGTTTTGAAACCTAA
Functional Annotation

Protein Analysis

109

Amino Acids

12.25

Weight (kDa)

6.02

Isoelectric Point (pI)

18.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 9, 287
AcsI RAATTY 1 cut(s) 146
AgsI TTSAA 2 cut(s) 262, 323
AluBI AGCT 2 cut(s) 265, 283
AluI AGCT 2 cut(s) 265, 283
AoxI GGCC 2 cut(s) 9, 287
ApeKI GCWGC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 146
AseI ATTAAT 1 cut(s) 276
AsuHPI GGTGA 1 cut(s) 253
BalI TGGCCA 2 cut(s) 11, 289
BauI CACGAG 1 cut(s) 293
BbvI GCAGC 1 cut(s) 198
BccI CCATC 2 cut(s) 192, 293
BfaI CTAG 4 cut(s) 110, 131, 188, 315
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
BseGI GGATG 1 cut(s) 304
BseXI GCAGC 1 cut(s) 198
BshFI GGCC 2 cut(s) 11, 289
BsnI GGCC 2 cut(s) 11, 289
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 2 cut(s) 11, 289
BssMI GATC 1 cut(s) 91
BssSI CACGAG 1 cut(s) 293
Bst2BI CACGAG 1 cut(s) 293
BstDEI CTNAG 1 cut(s) 233
BstEII GGTNACC 1 cut(s) 241
BstF5I GGATG 1 cut(s) 304
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstPI GGTNACC 1 cut(s) 241
BstV1I GCAGC 1 cut(s) 198
BstXI CCANNNNNNTGG 1 cut(s) 19
BsuRI GGCC 2 cut(s) 11, 289
BtsCI GGATG 1 cut(s) 304
BtsIMutI CAGTG 1 cut(s) 41
CviJI RGCY 5 cut(s) 11, 25, 265, 283, 289
CviKI_1 RGCY 5 cut(s) 11, 25, 265, 283, 289
DdeI CTNAG 1 cut(s) 233
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
EaeI YGGCCR 2 cut(s) 9, 287
Eco32I GATATC 1 cut(s) 81
Eco91I GGTNACC 1 cut(s) 241
EcoO65I GGTNACC 1 cut(s) 241
EcoRV GATATC 1 cut(s) 81
FaiI YATR 3 cut(s) 55, 105, 205
Fnu4HI GCNGC 1 cut(s) 212
FokI GGATG 1 cut(s) 311
Fsp4HI GCNGC 1 cut(s) 212
FspBI CTAG 4 cut(s) 110, 131, 188, 315
GluI GCNGC 1 cut(s) 212
HaeIII GGCC 2 cut(s) 11, 289
HphI GGTGA 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 41
HpyF3I CTNAG 1 cut(s) 233
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 35, 224
Lsp1109I GCAGC 1 cut(s) 198
MaeI CTAG 4 cut(s) 110, 131, 188, 315
MaeIII GTNAC 2 cut(s) 241, 302
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MlsI TGGCCA 2 cut(s) 11, 289
MluCI AATT 2 cut(s) 146, 200
MluNI TGGCCA 2 cut(s) 11, 289
MmeI TCCRAC 1 cut(s) 100
MnlI CCTC 3 cut(s) 184, 187, 289
Mox20I TGGCCA 2 cut(s) 11, 289
MscI TGGCCA 2 cut(s) 11, 289
MseI TTAA 2 cut(s) 164, 276
MslI CAYNNNNRTG 1 cut(s) 297
Msp20I TGGCCA 2 cut(s) 11, 289
NdeII GATC 1 cut(s) 91
NmuCI GTSAC 1 cut(s) 241
PkrI GCNGC 1 cut(s) 213
PshBI ATTAAT 1 cut(s) 276
PspEI GGTNACC 1 cut(s) 241
RseI CAYNNNNRTG 1 cut(s) 297
SaqAI TTAA 2 cut(s) 164, 276
SatI GCNGC 1 cut(s) 212
Sau3AI GATC 1 cut(s) 91
SetI ASST 4 cut(s) 54, 267, 285, 329
SmiMI CAYNNNNRTG 1 cut(s) 297
Sse9I AATT 2 cut(s) 146, 200
SspI AATATT 1 cut(s) 18
SspMI CTAG 4 cut(s) 110, 131, 188, 315
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 146, 200
Tru1I TTAA 2 cut(s) 164, 276
Tru9I TTAA 2 cut(s) 164, 276
TscAI CASTG 1 cut(s) 41
TseFI GTSAC 1 cut(s) 241
TseI GCWGC 1 cut(s) 211
Tsp45I GTSAC 1 cut(s) 241
TspRI CASTG 1 cut(s) 41
VspI ATTAAT 1 cut(s) 276
XapI RAATTY 1 cut(s) 146
XspI CTAG 4 cut(s) 110, 131, 188, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.