Rh2AG445300

K( ) efflux antiporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
65785886 .. 65787305
1420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG445300.1

Sequence Viewer

Length: 258 bp
ATGGTTGTCAAGGGATTCGGATACAACAACAAAACATCATTCCTAGTTGGAATATCTCTAGCACAGATAGGCGAATTTGCTTTTGTTCTTTTAAATCGTGCCTCTAATCTCCATCTAGTCGAGGATGGAGACATGTTTTGGAGGATGCGTGAGTGCTACATCCATGGAAATACTACTAAGTATCTGCGAGTTCCGGATCCTGATGGGGTAGTTCCTAGTGTCGTTGCCCTTGTGTCATTGCCCTTGTATATCAGGTGA
Functional Annotation

Protein Analysis

85

Amino Acids

9.56

Weight (kDa)

7.91

Isoelectric Point (pI)

21.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 193
AclWI GGATC 2 cut(s) 191, 204
AcsI RAATTY 1 cut(s) 74
AflIII ACRYGT 1 cut(s) 132
Alw26I GTCTC 1 cut(s) 123
AlwI GGATC 2 cut(s) 191, 204
Aor13HI TCCGGA 1 cut(s) 193
ApoI RAATTY 1 cut(s) 74
BamHI GGATCC 1 cut(s) 196
BccI CCATC 3 cut(s) 119, 120, 197
BciVI GTATCC 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 123
BfaI CTAG 4 cut(s) 44, 59, 116, 216
BfuI GTATCC 1 cut(s) 14
BmiI GGNNCC 1 cut(s) 198
BmsI GCATC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 133, 163
Bse3DI GCAATG 1 cut(s) 236
BseAI TCCGGA 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 3 cut(s) 130, 150, 159
BseMI GCAATG 1 cut(s) 236
BsiSI CCGG 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 123
Bsp13I TCCGGA 1 cut(s) 193
Bsp143I GATC 1 cut(s) 196
Bsp19I CCATGG 1 cut(s) 163
BspEI TCCGGA 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 198
BspPI GGATC 2 cut(s) 191, 204
BsrDI GCAATG 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 177
BstDSI CCRYGG 1 cut(s) 163
BstF5I GGATG 3 cut(s) 130, 150, 159
BstKTI GATC 1 cut(s) 199
BstMAI GTCTC 1 cut(s) 123
BstMBI GATC 1 cut(s) 196
BstNSI RCATGY 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuI GTATCC 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 163
BtsCI GGATG 3 cut(s) 130, 150, 159
CviAII CATG 2 cut(s) 133, 164
DdeI CTNAG 1 cut(s) 177
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
DraI TTTAAA 1 cut(s) 93
Eco130I CCWWGG 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 163
FaeI CATG 2 cut(s) 136, 167
FaiI YATR 3 cut(s) 134, 165, 249
FatI CATG 2 cut(s) 132, 163
FokI GGATG 3 cut(s) 137, 146, 157
FspBI CTAG 4 cut(s) 44, 59, 116, 216
HapII CCGG 1 cut(s) 194
Hin1II CATG 2 cut(s) 136, 167
HinfI GANTC 1 cut(s) 15
HpaII CCGG 1 cut(s) 194
Hpy188I TCNGA 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 194, 200
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 2 cut(s) 136, 167
Kpn2I TCCGGA 1 cut(s) 193
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 3 cut(s) 207, 213, 238
LweI GCATC 1 cut(s) 135
MaeI CTAG 4 cut(s) 44, 59, 116, 216
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MflI RGATCY 1 cut(s) 196
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 3 cut(s) 112, 115, 135
MroI TCCGGA 1 cut(s) 193
MseI TTAA 1 cut(s) 92
MspI CCGG 1 cut(s) 194
NcoI CCATGG 1 cut(s) 163
NdeII GATC 1 cut(s) 196
NlaIII CATG 2 cut(s) 136, 167
NlaIV GGNNCC 1 cut(s) 198
NspI RCATGY 1 cut(s) 136
PciI ACATGT 1 cut(s) 132
PfeI GAWTC 1 cut(s) 15
PscI ACATGT 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 198
PsuI RGATCY 1 cut(s) 196
SaqAI TTAA 1 cut(s) 92
Sau3AI GATC 1 cut(s) 196
SetI ASST 1 cut(s) 257
SfaNI GCATC 1 cut(s) 135
Sse9I AATT 1 cut(s) 74
SspMI CTAG 4 cut(s) 44, 59, 116, 216
StyI CCWWGG 1 cut(s) 163
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 74
TfiI GAWTC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
XapI RAATTY 1 cut(s) 74
XceI RCATGY 1 cut(s) 136
XspI CTAG 4 cut(s) 44, 59, 116, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.