RchiOBHm_Chr2g0167881

Trafficking protein particle complex subunit 5-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
82231989 .. 82232657
669 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53564

Sequence Viewer

Length: 132 bp
ATGAAGCTACTGCCTAACGTCCTCGACAGGCCTCTCAGCAAAGGAAAACAAGAGGTCAGTTTGAGTGCATTTTCGTTCTTGTTTTCGGAGCTTGTGCAATACAGCCAAACACAGGTTGACAACATTGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

43

Amino Acids

4.84

Weight (kDa)

5.97

Isoelectric Point (pI)

31.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 112
AluBI AGCT 2 cut(s) 7, 91
AluI AGCT 2 cut(s) 7, 91
AoxI GGCC 1 cut(s) 29
BfaI CTAG 1 cut(s) 130
Bsc4I CCNNNNNNNGG 1 cut(s) 112
Bse3DI GCAATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 112
BseMI GCAATG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 49
BshFI GGCC 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 112
BsnI GGCC 1 cut(s) 31
BspANI GGCC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 48
BsrDI GCAATG 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 35
BsuRI GGCC 1 cut(s) 31
CviJI RGCY 4 cut(s) 7, 31, 91, 105
CviKI_1 RGCY 4 cut(s) 7, 31, 91, 105
DdeI CTNAG 1 cut(s) 35
Eco147I AGGCCT 1 cut(s) 31
FspBI CTAG 1 cut(s) 130
FspEI CC 9 cut(s) 13, 27, 27, 35, 38, 45, 71, 98, 119
HaeIII GGCC 1 cut(s) 31
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 118
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 2 cut(s) 68, 97
HpyF3I CTNAG 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 18
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 13, 98
MaeI CTAG 1 cut(s) 130
MaeII ACGT 1 cut(s) 18
MnlI CCTC 3 cut(s) 32, 42, 46
PceI AGGCCT 1 cut(s) 31
SetI ASST 5 cut(s) 9, 21, 57, 93, 117
SgeI CNNG 6 cut(s) 35, 40, 62, 91, 104, 125
SseBI AGGCCT 1 cut(s) 31
SspMI CTAG 1 cut(s) 130
StuI AGGCCT 1 cut(s) 31
TaiI ACGT 1 cut(s) 21
TaqI TCGA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.