Rh7BG051000

Sarcoplasmic reticulum histidine-rich calcium-binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
3350721 .. 3351664
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG051000.1

Sequence Viewer

Length: 294 bp
ATGCGTGACAGAAGAAGCAGATCTTTAGGGAAGTCATCAGATGACAACCATGATGAGGCAGGTAAACATTTGAAGGACAAGAAAAATGGCCACCACCATCATCATAGACATGGTCACAATCATTACTCAGGAGAGGAGAAAGATCACCATCATCGGGATTCAGTTAAGCCCCATGGAAAGCACATCAAAGACCACAGTAGAAATGGAACTGATGACATTAATGATGGGTATCATGAAATTGGTTCTCAGGAGTTTAGACTTTCATTCAACACACAAACGGAAAATGTCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.37

Weight (kDa)

8.17

Isoelectric Point (pI)

42.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 50
AcoI YGGCCR 1 cut(s) 88
AfiI CCNNNNNNNGG 2 cut(s) 55, 154
AgsI TTSAA 2 cut(s) 73, 268
AoxI GGCC 1 cut(s) 88
AseI ATTAAT 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 137
BalI TGGCCA 1 cut(s) 90
BccI CCATC 3 cut(s) 105, 156, 218
BfuAI ACCTGC 1 cut(s) 50
BglII AGATCT 1 cut(s) 20
BsaBI GATNNNNATC 2 cut(s) 147, 228
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 154
Bse8I GATNNNNATC 2 cut(s) 147, 228
BseDI CCNNGG 1 cut(s) 172
BseJI GATNNNNATC 2 cut(s) 147, 228
BseLI CCNNNNNNNGG 2 cut(s) 55, 154
BseMII CTCAG 2 cut(s) 141, 260
BseRI GAGGAG 1 cut(s) 149
BshFI GGCC 1 cut(s) 90
BslI CCNNNNNNNGG 2 cut(s) 55, 154
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 2 cut(s) 20, 142
Bsp19I CCATGG 1 cut(s) 172
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 140, 259
BspHI TCATGA 1 cut(s) 232
BspMI ACCTGC 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 2 cut(s) 20, 142
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 197
BstDEI CTNAG 2 cut(s) 127, 246
BstDSI CCRYGG 1 cut(s) 172
BstKTI GATC 2 cut(s) 23, 145
BstMBI GATC 2 cut(s) 20, 142
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BsuRI GGCC 1 cut(s) 90
BtgI CCRYGG 1 cut(s) 172
BveI ACCTGC 1 cut(s) 50
CciI TCATGA 1 cut(s) 232
CviAII CATG 4 cut(s) 50, 110, 173, 233
CviJI RGCY 2 cut(s) 90, 169
CviKI_1 RGCY 2 cut(s) 90, 169
DdeI CTNAG 2 cut(s) 127, 246
DpnI GATC 2 cut(s) 22, 144
DpnII GATC 2 cut(s) 20, 142
EaeI YGGCCR 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 4 cut(s) 53, 113, 176, 236
FaiI YATR 5 cut(s) 51, 105, 111, 174, 234
FalI AAGNNNNNCTT 2 cut(s) 7, 39
FatI CATG 4 cut(s) 49, 109, 172, 232
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 4 cut(s) 53, 113, 176, 236
HinfI GANTC 1 cut(s) 158
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 4 cut(s) 129, 155, 233, 248
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 197
HpyF3I CTNAG 2 cut(s) 127, 246
Hsp92II CATG 4 cut(s) 53, 113, 176, 236
Kzo9I GATC 2 cut(s) 20, 142
LpnPI CCDG 3 cut(s) 45, 114, 233
MaeIII GTNAC 2 cut(s) 5, 113
MalI GATC 2 cut(s) 22, 144
MboI GATC 2 cut(s) 20, 142
MboII GAAGA 1 cut(s) 24
MflI RGATCY 1 cut(s) 20
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 1 cut(s) 237
MluNI TGGCCA 1 cut(s) 90
MnlI CCTC 2 cut(s) 49, 127
Mox20I TGGCCA 1 cut(s) 90
MscI TGGCCA 1 cut(s) 90
MseI TTAA 2 cut(s) 165, 219
MslI CAYNNNNRTG 1 cut(s) 108
Msp20I TGGCCA 1 cut(s) 90
NcoI CCATGG 1 cut(s) 172
NdeII GATC 2 cut(s) 20, 142
NlaIII CATG 4 cut(s) 53, 113, 176, 236
NmuCI GTSAC 2 cut(s) 5, 113
PagI TCATGA 1 cut(s) 232
PfeI GAWTC 1 cut(s) 158
PflFI GACNNNGTC 1 cut(s) 111
PshBI ATTAAT 1 cut(s) 219
PsuI RGATCY 1 cut(s) 20
PsyI GACNNNGTC 1 cut(s) 111
RseI CAYNNNNRTG 1 cut(s) 108
SaqAI TTAA 2 cut(s) 165, 219
Sau3AI GATC 2 cut(s) 20, 142
SetI ASST 1 cut(s) 64
SmiMI CAYNNNNRTG 1 cut(s) 108
Sse9I AATT 1 cut(s) 237
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 197
TasI AATT 1 cut(s) 237
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 165, 219
Tru9I TTAA 2 cut(s) 165, 219
TseFI GTSAC 2 cut(s) 5, 113
Tsp45I GTSAC 2 cut(s) 5, 113
TspDTI ATGAA 2 cut(s) 249, 252
TspGWI ACGGA 1 cut(s) 293
Tth111I GACNNNGTC 1 cut(s) 111
VspI ATTAAT 1 cut(s) 219
XcmI CCANNNNNNNNNTGG 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.