RchiOBHm_Chr3g0451201

Aldo/keto reductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0015644
Physical Location & Seq
Forward (+)
2392058 .. 2393366
1309 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41849

Sequence Viewer

Length: 165 bp
ATGGGACTTAATGGAATCTATAATGTGCCAGTTTCTGAAGAGTTTGGCATACCAATGATCAAGTACGCATTTGACAGAGGAATAACATTCTTCGATACATCAGATGTTTATGGACCACATGCTAATGAAGTTTTGATCGGAAAGGCATTGAAGCAGCTGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Aldo_ket_red

Protein Analysis

54

Amino Acids

5.97

Weight (kDa)

4.95

Isoelectric Point (pI)

22.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldo_ket_red PF00248 4 - 52 1.6e-10 Aldo/keto reductase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
AlwNI CAGNNNCTG 1 cut(s) 35
ApeKI GCWGC 2 cut(s) 154, 157
AspS9I GGNCC 1 cut(s) 113
AvaII GGWCC 1 cut(s) 113
BbvI GCAGC 1 cut(s) 144
BclI TGATCA 1 cut(s) 57
BisI GCNGC 2 cut(s) 155, 158
BlsI GCNGC 2 cut(s) 156, 159
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 29
BseXI GCAGC 1 cut(s) 144
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 2 cut(s) 57, 135
BsrI ACTGG 1 cut(s) 29
BssMI GATC 2 cut(s) 57, 135
Bst6I CTCTTC 1 cut(s) 33
BstKTI GATC 2 cut(s) 60, 138
BstMBI GATC 2 cut(s) 57, 135
BstNSI RCATGY 1 cut(s) 122
BstV1I GCAGC 1 cut(s) 144
CaiI CAGNNNCTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 113
Csp6I GTAC 1 cut(s) 64
CviAII CATG 1 cut(s) 119
CviJI RGCY 1 cut(s) 157
CviKI_1 RGCY 1 cut(s) 157
CviQI GTAC 1 cut(s) 64
DpnI GATC 2 cut(s) 59, 137
DpnII GATC 2 cut(s) 57, 135
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 57
FaeI CATG 1 cut(s) 122
FaiI YATR 4 cut(s) 21, 50, 111, 120
FaqI GGGAC 1 cut(s) 18
FatI CATG 1 cut(s) 118
FbaI TGATCA 1 cut(s) 57
Fnu4HI GCNGC 2 cut(s) 155, 158
Fsp4HI GCNGC 2 cut(s) 155, 158
FspEI CC 8 cut(s) 30, 42, 63, 66, 96, 123, 128, 129
GluI GCNGC 2 cut(s) 155, 158
Hin1II CATG 1 cut(s) 122
HinfI GANTC 1 cut(s) 15
Hpy188I TCNGA 3 cut(s) 37, 103, 140
Hsp92II CATG 1 cut(s) 122
Ksp22I TGATCA 1 cut(s) 57
Kzo9I GATC 2 cut(s) 57, 135
LpnPI CCDG 1 cut(s) 42
Lsp1109I GCAGC 1 cut(s) 144
MalI GATC 2 cut(s) 59, 137
MboI GATC 2 cut(s) 57, 135
MboII GAAGA 2 cut(s) 50, 82
MnlI CCTC 1 cut(s) 71
MseI TTAA 1 cut(s) 9
MslI CAYNNNNRTG 2 cut(s) 53, 123
MspA1I CMGCKG 1 cut(s) 157
NdeII GATC 2 cut(s) 57, 135
NlaIII CATG 1 cut(s) 122
NspI RCATGY 1 cut(s) 122
PfeI GAWTC 1 cut(s) 15
PkrI GCNGC 2 cut(s) 156, 159
PspPI GGNCC 1 cut(s) 113
PstNI CAGNNNCTG 1 cut(s) 35
PvuII CAGCTG 1 cut(s) 157
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
RseI CAYNNNNRTG 2 cut(s) 53, 123
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 2 cut(s) 155, 158
Sau3AI GATC 2 cut(s) 57, 135
Sau96I GGNCC 1 cut(s) 113
SetI ASST 1 cut(s) 159
SgeI CNNG 3 cut(s) 41, 73, 131
SinI GGWCC 1 cut(s) 113
SmiMI CAYNNNNRTG 2 cut(s) 53, 123
TaqI TCGA 1 cut(s) 93
TfiI GAWTC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TseI GCWGC 2 cut(s) 154, 157
TspDTI ATGAA 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 113
XceI RCATGY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.